GenePrediction:GLEAN_4263 Details

Name: GLEAN_4263
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1058767..1057750 (- strand)
Length: 1018
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1058767..1058475 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_179:1058361..1058106 (- strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_179:1058046..1057750 (- strand)
Length: 297
>GLEAN_4263 class=GenePrediction position=GCSC_179:1058767..1057750 (- strand)
ATGCCCTTGCTACGGCTTTTATCTACCGTTCCAGTTGTCATAAAACCGAGCTCGAAAGAGATCAGGTCGAATACACTAAA
TGAGCGGAGCTTGGAGACAGCTATCCGGCAGGTCCACCTCGACGGACTCGTCGTGGTTGAAGATGTGGTTCCGCACGAGC
ATATCGACATCCTGAACAAGAAGATGATTGCTGATGCACGGCAGCTTCAGGCCCGTGGGGAGGACGGGCCCTTCAACTAC
AATCTTGGAAACATACAGCAGGTTGCGCCTCCCGTTGCCGAATACTTTTACCCGTCCGTTTTCATGAATATGATTACTGT
GCTGTCTTAGCAAATTAAGGCCTGAGTGCATTTGCTAATTCGTTCTCACATATTTCAGATCCCATTGTCACGCAAATCAC
AACTAGCGACTTCGGCCCACGCCCCAAGTGGACCTTTTGTTCTGCAAACACGGCCATGCCTCCAGTCTCAAACACTGCGC
CGCCTCAGCGACAGCCGGTCCACACTGACGCCGACTTTGCCCATCCGGCCCATCCATTTGCGTTGGTGGTCAACGTGCCG
CTCGTCTGCATGACGCCCCGAAACGGCTCGACCGAGATCTGGCTGGGCACGCACAACACCGCGGAATCACCGCACAGGAG
GGCCAGCACGGCGAGCGAGCCAGTGGGCGCATCCTCGAAAGTCTGCTGCTTGAAAGATGCCTCATCCTTGAACCATCACA
GCCCGTCATCAATAAGGGCAGTATCGTCATGTGCGACCTTCGCTTGTGGCACGCTGGTATGCTCAACTGGACCGACGAGG
TGCGCGTCATGCTCGCCTGTATCCATTTTGCGTCTTGGTATCGCAACCCAATGCAGCTCGAATTCTGTGAGGATATCAAG
CCAATTCTCGAGGCTATGGATCGAAAGGGAATGCTAGAGCTTCAAACGCCTGTACGCTGGGTATCCGTCGATTACGCCCT
CAACACTTACCTCAACAGAGCCTTTGGAAATGCCTACAACTTTGATCAGACCCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62