GenePrediction:GLEAN_4264 Details

Name: GLEAN_4264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1054413..1051725 (- strand)
Length: 2689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1054413..1053597 (- strand)
Length: 817
Type: CDS
Source: GLEAN
Position: GCSC_179:1052654..1052538 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_179:1052395..1051725 (- strand)
Length: 671
>GLEAN_4264 class=GenePrediction position=GCSC_179:1054413..1051725 (- strand)
ATGTCAAAGATCTACGAGATTGACCCCGATGCGGACACGCTTGTCGTCGTGCGGGCGCTGGCAGAGCCGTTTGCGCCGTG
GCCCGTGCAGAAGGGAAACGCCCCTGCTGGGGCGACAGGCAAGAAGGCAGATACCCACGAGGTACGCATCAAGGCGTCGT
CTAAGCACCTGAGCTTGGCGTCGACGTACTTCCGCGATCGCTTCAGGTGGAAGTCGGCGGCTGCAGGCTTCGGCTTGGAC
GGGGTCCTTGGCGTGCAGCCAGATGGGAGGGTCCATGTCGTCCTCGAGGGGCTGGACGGCGCGGCCACAACGGCAGTGCT
GAACATTGTGCATGGACGCAGTGGCGACCAGCGGGTGCCACGGACAGTTGAACTGGACTCTTTGGCACGCATCGCCGTCG
TCTTGGATCGATTTCAGCTGCAGGAAGCCGTGGACGTGTATGCGGAGCGCTGGATCGGGGCGCTGCGCCGACGCGGGCTG
CCGACGCGCAGCGGCCGCGACCTCGTGCTGTGGATCTATATCGCATATGTCTTCCAGCGTGACGACATCTTCCGTGAGGT
CGCGCGCGTGGCTGCCACCCAAGGCGCAGGCCCACTGCCATCAACTTTGCCGGGGCTGCCGCTGCGCACGCGGATCGCCC
AGGACGTCGAGGAGCAGCGACAACAGGCGATTGCGGCGGGGTTGGACCTTCTGCACGGTGCAGTGGACTTGTTGCTGAAA
TCAGACGATGGGGCTGGCGATAACGAAGCTGTCTTGCTGGGCATCCTCCTCAAGACACTGCAGCGAAACGGCCTAACATG
GCCGCAGCTAAGAAACCGTACGCTGGCGTGTCGGTGGCATCGATCAGCCGTGCTGCACATGCAGTCCAGACACAAGTCTG
GCGTCTGGGGGGCAGTGATAGCAAGCGTTTGCTGCTCAATCCCCAACTCGACACCCTCAGAGCCGACATTGCGGGCTTGG
ACTTGAAAAGCGATTACGGATATCAGTTGTACTAATTGAGAAAGATGAGGATGGCAAAGCAAGTACTCGGGATTTGTTGG
CTTTATGTGATTGGTACACGAAATTGGTACACGAAAATACCAATGCTTTGCTGATTGACGTTTGTCTGTATTGGTAGTCG
CCGAAAGCGATGCTTCTGTCCCTGATCCCACCTTCTTTTCCAGGGCTACGCAGTGCCTTATTTATCATGGCTTATTACCT
GGATACCATGTGCATGCTGTTGCTCATCAGTACAGCTCTAATTCTGTCTGTCCGCATGCTGTAGCTAACTAAACGCATTT
AGTACGGGGTGTACGGGGTAAATCCCCGTATTATCACCAATTATTTTCACTGCAGAGCCCATGCTAACTCGCCTTTTTAG
CGCATGTGACGAGAGGCGAGCATTTCTAACCGAAAATTACCCGTTGTACTCTCGTACATACCTGCCCATCACAATGACAG
GAAACGCCCGCCATCTCCACGACTCGAAGAACGTGATACGGAGTCAACAATTGCTCCATCTCCTCTGTATTGCTCCGCGT
TACGTCATGCGGGGTGGCTTCCAGCCTTCGTGCTTAGAAATCTTCGTGCTTAGAAATCAAGCATTTTCGCAATCGGTGGT
GCCACTCTACTTGCCGTTGATGGCCGGCGTACGGAGTAAAGCAGTAGCCAATGCGACGCGTATCTGCTACGCCTTCCCTA
TCCAGACAACGGCAGCCATTTATATTATAAGATATATAGCTGTTCCCTATTCCCATCAGAACAGCAACTAATAATACAGA
CACACATCCGCACAGCCAACATTGCTCATTCCTGCCTACCATCTCTACCGACCTCGTCCCGAACGTCATCATGGGCTCCG
ATAAGCTTGTCCTGTATACCAGTCACCTGTGCCCCTGTACGTAAGATGAAAGAAAGAAGAAACCCGAAAGCGAGAAAAAG
GAGGAAGACTCACGAATTTCGGGGAAAGACGGACTAGAAAAGATGCGAAAAGAAGCAGATAGAAACTAAAGACGGCTAAC
TGACATGCTCGCCTACAGGGGCCCACCGCGCGCACATTGCGCTTGCGGAGCTCGGCATCAAGGTTGAGGAGGTTATCATT
GACCTGGACCGGCCGCGCGACCCGTGGTATCTCGAAGTGAACCCGCGAGGCCTTGTGCCGTCGCTTAAGTACAATGACGA
GATCATCACAGAGTCAGCCATTGTCGCCACCTTCCTGGCCGACGCCTACCCGGACGCGGCGCCGCTGCTGCCGACGTCAA
CGAGCCCGGGCGGTGCCTTGACGCGCGCCCGCATCGCTTTCTTCGTCGACACTTACTTCACAAAGTTGCAATCCAACATC
TTCAAGCTGGGCGGCGTCAAGTCTGAGTCCGAGCAGGCCGCGCTGGCCACTGCCTTTGCCACCGCTGCCGCCAAGGAGCT
AGAGCCGTTGCTGACCAACACATCGGCCGAAAAGCCGTTCTTTGGTGGCAGCGCCCGTCTGACCCTCGCCGAGGTGCTCA
CTGGCTCCTTTGTGCTGCGCGTCGTCACGCTGTCCAAGCGCGGCGTCTACCCGAATTCCCTGCCGACGGTTGTGCCTGCC
CAGGCGCCCAAGTTCTGGGCCTGGGCCGAGGCTGTTGCCGCCCACCCCAGCGTCACTGGCATCTACGATGAGGACATCGT
GGCCAAGTCAACCAAGTCCCGGCTCGAGAAGCAGCGTGCGGGCCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62