GenePrediction:GLEAN_4265 Details

Name: GLEAN_4265
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1046581..1044274 (- strand)
Length: 2308
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1046581..1046460 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_179:1046375..1046033 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_179:1045832..1045037 (- strand)
Length: 796
Type: CDS
Source: GLEAN
Position: GCSC_179:1044962..1044274 (- strand)
Length: 689
>GLEAN_4265 class=GenePrediction position=GCSC_179:1046581..1044274 (- strand)
ATGGACTCTGCTACAGTTGTAGGATCCAACGTGGCAGCACCGAAACGCGGCAAGGCGTGCGTCAACTGCGTCCAAATCAA
GTGCAAGTGCATCCCTTGTGCTGGCAGAGATGGCTGCGCGAGGTATGTCTGTCCTTTTGCGATGTTTTTATTTATTCAAA
TTTCTACCTTCCACTCATTAGCTGTCCTTTTTACTGACCTGGAAAGATGCCTTCGGCTAAAGAAGACGTGCGTCCCATCG
CCCGCACCTGCTACGTCGAAGCGGGCTAAGGCAGCTGCGCGAACACGCCGTCTCGGCTCACACACGCAGCGGCTGGAGGC
TAAGCTTAACGACTTGGTCGACTTGTTGCGGACGACGCAGAGCATCGAGACCGGTGCCAGCGGAAGCGTACAGATTCGGC
CGTCGCCGTCGCCAACAGCCCCACAGGTCCTCGGGAAGACGCCCCAGACGACGGCGACAGTCACGGCTTCAGCTACGGCC
GCCGATGACAGCGACCTCTCGCCGGCCGAGGCCGAGGAAATATTCCGACTGTTTCAAGACGAGATGTTGGTGAGCTGTCT
CGTGTTTTCTTTTGTTGTTCAGTCGTTCCTTCCTTTATCCCTTCTGTCGCTCCTTCCTGCCCTCTGCTAATACCACACGT
TTCTAAATTTGTCTCCTTTCTCCTCCTCACCTCGCTTCCCATCCTCTTCCGTCTTTTCCTTGTATCAACTTCGTCAGTTG
TACCTTTTATTCCTCTTCTCACATCACAGCCTTTAGAACCGATCGTCTATTTAGCGCCCGATACCACAGCTCAGCAGCTG
CATCGCGATGCGCCCTTTCTCTGGCTCTGCATCATGGCCGTGGCCGCGACATCGAACCGACAGCGAAGTCGTCTGGGTGC
CCAGGCCCGCCAGCAGTTGCTGGACCAAGTCGTGGCCGCTGGCGAGCGCAGCCTACCCATCCTGTACGGCATCATCGTCC
TGCTGGCCTGGTTCCACGTTCTGCCTGCCGTGGACCGCCAATTTGCTGTCATGCTGTCACAGCTGGCTGTAGCTGTCGCC
TGGGACATGGGCCTCACCATGCCGGTGCCGCTTGACCAGAGAGCACCGGGACATGGCTGTGGCTCCGGCCTAACGGCCCC
TCCTGGCCGGTCTGCGGTGCCCCCCAAACACGAGCGCACCATGGAGGAGCGACGCGCCGTCTTGGCCGTCTTCTCAGTCA
CCATGGGCGTGCCCTTAATGCCGGACGGCCTCTTCTGGTCGCCCTATCTCGAAGACTGTCTGGCTCACGTTCAGCAGGCT
CAGCAGGCTCAACAAACCACCCCTCAGACCAGCCATGACGCCACCCTTATTCGCCACATCCGTCTTCGCCTGCTTAGCAG
CCAGATGCGCCGCGAGACCGCTTGGAGCAACGCAGCCGTCACGTCTACTGCCTTGCCGTATTCTTCCACCTCCTGGCACA
GCAACCTTGCCCCGGCTGCACCAGCCAGTCTGCCCTTTATCTTCATGGAGTCGGCCCAACTGTACCTCGATAGCATCGTC
AGCGAACCCTCATCACTGGACAATTGTAAGCCCAAAGCAAAGCAACTGGACTCCCTGCCGTTTTGATACCACACTGATTA
CCAATTCTCCTCAAACCAGTCGCTACCCACAACCTCTATCACTACGCCCGCCTTACAATTCACGAGTCAGCTCTCATACG
TCCCCCACCCCCTGGAGCTACCCTTGACTTCCGCCGGCTCGCCGTCTACGAGCGCTGCCTTGACTCTGTTCGCCAAACCT
TTGACAAACTATTCGGCTGTCCATCCGACCGCTACCTGCGCCTTCCTAATGGCTCAGTCTGTTTGACCCTCTATGTCGCC
GTCTGTCTTCACCGTCTCAGCACACTTCGTGACCGGTCGTGGAGTGTCGAGGCCGTACGTGATTCTATCGATCTGATCAC
CACCGTCGACCGTGTCATTTCCATTTTTCAGTCCTGCCAGCTGCAAATGATACCGACCTCATCCACAACACATGACACCA
ACGGTGGCACTGCACCAAATGGTTCCTCGCCCTCCCTAGCTTCTGCCGACACCGTCGTCGCTGCTTTTGCCATGCGCAAG
TTCCAGGCTCTCCGTGCTGTCTGGCTGAGCGACTATCCACCGCGCCATAGCCCCAGTAGCAGTGCTACCATCACCACTAC
AACCACTACAACCCACACTGCCACCGAAACACCCTCTGTATCTGCTCTACCTCTCTTCCCCTCCATGCCTCTCCCGCTGA
CTGCTGTGGACGATTTCGACTGCTACCAATGGCTTCCAGACCTGGCTATAGGCGTGTCCTGGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62