GenePrediction:GLEAN_4269 Details

Name: GLEAN_4269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1022975..1022197 (- strand)
Length: 779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1022975..1022569 (- strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_179:1022497..1022197 (- strand)
Length: 301
>GLEAN_4269 class=GenePrediction position=GCSC_179:1022975..1022197 (- strand)
ATGGCTCTGGGCCATTCGCCCTTTACAGCTCCTCTCTTCCAAGTGGACAAGACGCTGAATACAGACGAGATCCACGCCAA
CATTTTGCAAACATGGCCATACAACCGCATAATCAACTCAAAAGGCCTGGCCAATCACACGGCTGAATATACTGACGCTG
TCGGCGAGACCATCTATCTGACAGATGAGCGGGTTTTTGTCACATTCGAGGATGGTGACAGTCTCGAGCCCGCGCACAGC
CTTGATGAGTGCATCAAGAGGCCAGCGCAGCGGAAGGTATTGCGCACGCAGACCTTTTGGGATCCCTGGGTCCCCGTCTC
CAACACGGTCAAATCCGGAAAAGATGAGTCGGGTGGCTATGTGACGTTTGAGTTTTCTGTCACGAAGGGAACATCGACAG
ATTTGGGGTGAGCATTTTCGGGACTCCTCTTGCGTCTGTGGAACGTCCTCGTATCCCATACCTAAACTCAATGGCCAGAT
TTGCTCTAGGGCCGTTCAAGGACATTATCGGAGGCAGCGTCGGCCTCTCTCTCAGCATCGACTACACCTATGGCAGCACG
ATCGCCTGCAATGTCCCCGGGGGCAGTATCGGGCAGGTCTGGGGCCGCCACTGGATGGCGTGGGCTGAAGTTCAACAGAA
GAATTGCAACACATGTGGCGGCTGCATCATTCAGACTGGCTTTGCGCTGATGCCACAGAACGACTACAAGAACGGGGAGG
ACTTTGGCTGCTCGGCCGGCTACGATAATGTCCTCGACCCTCCTAACCCACCACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62