GenePrediction:GLEAN_426 Details

Name: GLEAN_426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1701804..1703531 (+ strand)
Length: 1728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1701804..1702223 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_167:1702304..1703291 (+ strand)
Length: 988
Type: CDS
Source: GLEAN
Position: GCSC_167:1703362..1703531 (+ strand)
Length: 170
>GLEAN_426 class=GenePrediction position=GCSC_167:1701804..1703531 (+ strand)
ATGCTGCTGTCCCGCAGCGCAGCGGCCGGCCCTTCCAAGGCGTCGGCCCAGACGCTCGCCCGCGTGTGTGTCTCATCGCC
GGGATCGTCCGCAACAGTGTCGGCCTCATCGACGGCCTCCTCCTCTCCCGCCTCCGCCTTCAGATCTGCTTCAAGACATC
CGTCGTCAAGGCGGGCCTTTGCCACGGTCCAGGACGCCGCGCCGCCAAAGCGGACGTATGGCGGACTCAAGGACCAAGAC
CGCATTTTCCAGAACCTCTACAGCCGCTACCCGCCCGACCTGAAGCACGCCCGCAAGATGGGCGACTGGCACAAGACCAA
GGAGATTCTGCTCAAAGGCCACGAATGGATCATCAGCGAGGTCAAGGCGTCCGGTCTGCGCGGCCGCGGCGGTGCTGGTT
TTCCCTCGGGTCTGAAATGGGTGTGTATAAGGTTGGGCCAGCTGGCCTTGTCCCACTATCTCCTTCCCCATCGTGTGTTC
TCTCCCCGCTAATGGTCCAGTCGTTTATGAACTTTAAGGACTGGGACAAGGACAACAAGCCTCGCTATCTGGTGGTCAAT
GCCGACGAGGGTGAGCCGGGCACCTGCAAGGACCGCGAGATTATGCGCAAGGACCCGCATAAGCTGGTCGAAGGCTGTCT
GATCGCTGGTCGGGCCATGAACGCCACGGCCGCCTACATCTACATCCGCGGCGAGTTTGTGTACGAGGCCGAGGTGCTGC
AGGCAGCCATCAACGAGGCGTATGCCGAGGGCCTGATTGGCAAGAACGCCTGCGGCTCGGGCTACGACTTTGACGTGTTC
ATCCACCGCGGTGCTGGCGCCTACGTCTGCGGCGAGGAGACGTCGCTGATCGAGTCGATCGAGGGCAAGCCGGGCAAGCC
GCGGCTCAAGCCGCCCTTCCCGGCGGCCGTCGGTGTCTTTGGCTGCCCGTCGACAGTGACCAACGTGGAGACGGTGGCGG
TGGCGCCGACCATCTGCCGTCGTGGCGGCGCCTGGTTCGCCGGCTTTGGTCGTGAGCGCAACCAGGGCACCAAACTGTTC
TGCATTAGCGGCCACGTCAACAACCCGTGCACGGTCGAGGAGGAGATGTCCATTCCGCTACGCGAGCTGATCGACCGCCA
CTGCGGCGGCGTGCGCGGCGGCTGGGACAAACTGCTGGCCGTCATTCCCGGCGGCTCGTCTACGCCCATCCTGCCGAAGA
GCATGTGCGAGGACCAGCTGATGGACTTTGACGCCCTCAAGGACAGCCAGTCAGGCCTCGGCACCGCTGCCGTCATCGTC
ATGGACAAGAGCACCGACGTCGTGCGCGCCATCAGCCGTCTCAGCCACTTCTACCGCCACGAGTCGTGCGGCCAGTGCAC
GCCCTGCCGCGAGGGCAGCAAGTGGACCGAGCAGATCATGAGCCGCTTCGAGAAGGGCATGGGTCGCGAGCGCGAGATCG
ACATGCTGCAGGAGCTGACGAAGCAGGTCGAGGGACACACCATCTGTGGTAGGTTTTTCGTGTTTTTTTTCGTGTTTTTT
TTCTCTCCCTTTCTCTCTTCCTTTCTCTAACATCACAGCTCTTGGCGAGGCTTTCGCATGGCCCATCCAGGGCCTCATCC
GCCACTTCCGGCCCGAGCTGGAGGCCCGGATGCAGAAGTTTGCGGCAGAGAACGGCGGCGTCCCGCTGGCTGGCGGCTGG
CCACACGACACCCGGAAACAGGGTCACCTGGTCGCGCCCGGTCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62