GenePrediction:GLEAN_4271 Details

Name: GLEAN_4271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1017278..1016073 (- strand)
Length: 1206
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1017278..1017195 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_179:1017137..1016073 (- strand)
Length: 1065
>GLEAN_4271 class=GenePrediction position=GCSC_179:1017278..1016073 (- strand)
ATGCAGATCATTTTGCCTCTTGCGTGCCTGTCCGGCGCCTTCGCCGCGGTTCTCGAGCTGCCTATCTGGGTGCGGAACTC
TTATGTAAGGACCCGAGTCTCTAGTATATCTGCCTGCCGCATGAAGCTGACAAGAGTACAGACCGTCGTGGAGGTCAAAG
TGGGCACACCGCCTGTCTCGCACTTTCTCCAGTTCGACACCGGCAGCGCGACTACCTGGATGGACGATGCCTCCTGCGCC
GGGACCGATGCCTGCCCAAACTCGAGCGGCTACACACGCGTCGGCTACAATGCCTCGGGGTCCAGCACATCAGCGGCCAT
GAACACGACTGCGTCGGCCGACTACCTCGGCGGCGACATCTCTGGCTCCGGCTTCCTTGATTCATTCACCTTGCCGTCAG
CGCCCTCGGCCAAGTGGACGCAATCCTTTATGTCTGTTGACAATAGCACGTGGTCGACGACGGCCGCTGATGGCTTCCTG
GGTCTAGCGTTTAGCACAATTGACGATGCCGGCACGACATCACTGGTTGAGACGCTTATGCAGGATGGCAAGCTCGACAA
ACCGCGATTCGGCCTGTACCTCGGCAGCGAGACTAACGACACGGGCGCTGGCGCTGGCTCCGGTCTCTTGACACTGGGCA
GCTCGCACGAAACCACTTACGGAAACGGTTCGCTGACCTGGATCGGACTCCAGAACCCCGGCCCGGACGCGGAGCTGTGG
CGTACTAACATACAGTACCTTGTCGGCACGACATCCACTGGAAACCGCAGCACCACCCAGGCCATCGGCGACTGGGCCGT
CTTCGATACGGGCGCCGGCCGCATCTCTGTGCCAGATGAATTGATCGATGACATATACGCCTCCATCGGCATGAACTACA
CGGCCATCATCAACGGCGAAACGATCCCGCTGTGTGAAGACTTCACAGACGCCTGGGGCCTTGAAGTCGTCCTGGGGAGT
GCCTACGACCCGCAAACGGTGACCGTCACCGGGTCCATGCTGAAGCAGCCCGGGTTTGCTACTGGTGAGGACAAGTACTG
CTGGCCGCCATTCGATACAACTGGCTTCGGTGGACTGTTTTTGTTTGGCCAAGAGTTCCTGCAAAACTTTTACACCGTTT
TTGACTTTGGGGCTTTCAATACCACCGCCTATAACGCTCAGATTGGCTTTGCCCCTCTGAAAGAGGAGTACAGGGTGTTG
GTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62