GenePrediction:GLEAN_4273 Details

Name: GLEAN_4273
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1013603..1012155 (- strand)
Length: 1449
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1013603..1013373 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_179:1013178..1012996 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_179:1012934..1012654 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_179:1012583..1012512 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_179:1012443..1012408 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_179:1012347..1012155 (- strand)
Length: 193
>GLEAN_4273 class=GenePrediction position=GCSC_179:1013603..1012155 (- strand)
ATGTCTACTCACTCCCTCAAGTACTTGGCCGGTGGTGAGGACGGCAAAATCCGACTGAAGACGGCAGTCCGCAGCGTCAG
CGGAGTTGAGGTGCTCGTCCGCATCACCCACTCCGGCGTCTGCGGCACTGACGTCCATGACCGAGGACACGGCTGCGGGC
TTGGCCACGAAGGCATCGGCTTTGTGCAGGAGGTCGGCCGAGACGTCACGGCAGTGCAGGTTGGCGATCGGGTGGGATGC
AGGTGGGCCGCACGGATACCCCAAAAAAGCGTTGACCCAAGACATTTTTTGTGCTGACAACGCATGCATCACAGCTGGCA
GACAGGGGTATTGATTGGAGCCTTCCACCCCTCTCCTCCCCCAACGGACGATGCGTGGTGACCTGTAGACCTGCCGACCT
GCTGACTTCATCTGCGCTCGAACAGTCTTGCGGCCACTGTCGCGAATGCGTGTCTGGCTTTCGGCAGTGCTGCCCGAAGG
CTGTTGGGCAAGCGCACGGCGACCACGAGGGGTCGTTTAGCAACTTTGTCGTGCGGCACCAGGACTTTGTCTATCCCATC
CCAGCCGAGATCGAGTCTAGACATGCCGGGCCGCTGATCTGTGCTGGCGTAAGCAAAACCTGGAAGATGTCGGCCGTTCT
GCTGGACTGCCTGCTGACAGCCGCCCCAGATCACCGTCTTCGAGGGGCTCCAGATTGCCGAGACCAAGGCTGTCGATCGC
GTCGGCATCATCGGTCTGGGTGGCCTGGGCCACCTCGCCGTGCTCTACGCACGCGCCATGGGCTGTCACGTGACCGTCTT
TTCTGGCCGCGAGAGCAAGAAGGCCGATGCGCTGAAGCTGGGCGCGACAGACTTTCGGATCTGGCGGCCTGACAGCGCTG
TGGAGCAGTACTCGGACGCCAAAATTGACGTCATGCTACTCTGTGGCAGCGGAATGCCGGATCTCGAGTGGTACGATGCT
GTCCGAGAGGAGCGTCTCGCAGGTGTACGAAAACCAAGATGGGACTAACAAGCGTCACAGCATCATGCCGCTGCTCGGAC
GACGGGCTAGAATCGTGCCGCTGGTGATCCAGGACGAGCCCATGGTCATCCCGTTAGTGCCCATACGAGGCTACACTGTT
CGGCCGTACCCCAGTTTGTGACTTGTGACTGACCGTCTAGATACATGCCGTTCATCGTTGCCGGCCACCGTATCATGTAA
GCCGAGCCTCTTCCCTACCTGCTTTCTTTTGCTGCCCCCCGTCTAATTCTCCGCAGCGGAAGCACGACTTCGCAGACAGA
AAACTACGCCGCCGCGCTGAACTTGGCTGCACGCCACCGCATCCAGCCGTGGGTCGAAGAGTTCCCCATGACGGTGGAGG
GCCTGACCACAGCGATGGACAAGCTCCAGGAAGGCGTCGTGCTCTACCGGGCCGTACTCAGCAAGGAGCTTGGCAACGAG
CTGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62