GenePrediction:GLEAN_4274 Details

Name: GLEAN_4274
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1009999..1006167 (- strand)
Length: 3833
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1009999..1007377 (- strand)
Length: 2623
Type: CDS
Source: GLEAN
Position: GCSC_179:1007326..1006167 (- strand)
Length: 1160
>GLEAN_4274 class=GenePrediction position=GCSC_179:1009999..1006167 (- strand)
ATGTCACGGCGGCCTCACGGCCAGGCTGCCGCTCCCCAGCGGAAACTGTTCCTCGCTCTCGCCCTTTTTCTCCTCAACCC
TGCCCTCCGGCTCGTTGATGCTCAGCAGCAGCAGCAACATCCGCGGCAGCCATCCGGTCATGACACTGCCGACCAGCTGA
GCCAGCATGTCTTCCATCGCCTGGCCGCCGACGCAGGGCGGCAACTTCCAATAGCTGCTTCCTCCGACAGCAGCGCGTCT
TCGAGACGCTCAAACCATCAGCAACAAAAACAACAAGCACAGGCGGCAATGAGCTACTCCTCGCCGGCCGAGGCCGAGTC
GTTTATCGCGTCGCAGCTGACGGTCGAGACGCCCAAGATCCAGCGCAAGCGCACATCCATTGACAACGGCCGCGGGTCGG
ACTCGACGGTGCCTGTCGAACGGGAGAGAGAGAGAGAGGCGGGCCACAGGAAGCCCCGAACGAGATCCACTGCAGCTCCG
GACTTGTCCGTTCGAGCACCATCGCTAGCGTACCGAGACCTGGCCGCCGCTGCTCCCGGCCAGAATCTCCCCTCGCCGCA
TCTTCTTGCGCGGACGCTAGCCGACTGGGAAGTGGAACACTTTGTCCTCCTGGCCACGGTCGACGGCGACCTGCTCTCGG
TCGACCGCAAGACCGGCAAGATCCAGTGGCACATCGAGAGCGAGAAGCCCGTGGTCGAGACCAAGCACCACCGCAGCAAT
GTCTCCACTCTGGACGAGTCCTTCTTGCCGCTCGACCACTGGATTTGGGCTGTCGAGCCGACGCGCAGCGGCGCCATCTA
TCTCATGATCCCGGGCAGTCCCAGCCTGGCTGAGACCGGCCTGTCGATGAAGTGGCTGGTCGAGCAGGTGCCCTACTACG
ACCGCAACCACCCGGTCGTGTTCACTGGCACCAAGTCCACCACCATGGTCACCCTCGATGCCGCCACCGGCCGTGTGCGC
GCGTGGTATGGCACCGGCGAGGCCGATTCGGACGCCGCCGACGCCTACAACTCGCCCGACAGCTGCATGCGGCCCAACAA
CTTTGGCGAGAGCGGCGGTGAGGAGTGTGCCGTTGGCGGCTCCATCACGCTTGGCCGCACCGACTACAAGGTCATTGTCC
GTCGCAACGACGGCATCACCATTGCCACGCTCAAGTACTCTGAGTGGGGTCCCAACAACTACGACAAGGACCTGCACCAA
CAGCACAAAGCCCCCAGCGACAACCGCTACATCAGCGGCCTGCCCAATGGCGACGTGTACGGATTCAGCTTCGATCCCGT
TGTTGACGGCGTCAAGCTGGCCTTTAGCCACCGCCTGTCAGCCCCGATCGCCCGCGTCTTCGACATTGCGCGCCCGCCCC
ATGTGCCGCTAAGCAGCTATCCCGACCTGGCCGTGCTGCCACAGCCGCCGCCGCCGGCCGAGGACGACGAGGCAGTGCGG
CTGCGTAAGTCGACCATCTTTATAAATGAAACGAAAGGCGGTAGCTGGTACGCTCTCTCGGGCACCTCGTACCCGCTCAT
CCTCGACGTGCCCGCTGCTGAGTGCACCGAAGCCGGCTGGTGGGACCGACACCAGACCAGTGGCCCGGCCGAGATCCGTA
ACGCTCTGACCGGGAAGCACTCCCTGTCGACTGGGGCGGAGCGGCAGCGCTCGTTCCGGGCACCCGAGTACCCGACCCTA
CCCGGCAGCGATGCGTCAGCGACTGTTTCCGACGACGACGTGGAGGACCTGCTCTCGCCGCCGCTCACGCTGCCAGAGCC
AGCGACCGAGCCGTCTCCTTACGTGATCACCAAGGTCAAGGAGCTGCCGCAAGTCGCGGCCAACAGCGTGCTCGACTTCT
TGAGCAACCCGGTCTTCATCATCGCCTTTGCCACCTTTCTCTTCCTCTACCAGAAGGATCTACGACGCTGGTACAGAAAG
AAGAAACAGCAATGGTTCGACAAGGGCGTCGCCCTCGACACATCCGACGACGAGTCCTCCTCCGTCATCAGAGGGACGGC
TGATGGGACAGACACCACTGCCAAGGTGCAGCCTGCAGACTTGTCGCAGTCCGGCCTGCTCTCGGATAAAGAGGATGGCG
CGTCCGAGAGGAGAGCGACGCGGGCCGGCTCGGCGGAGACAACAACAGCAACCGCCGATCAGGACAAGGGCAACGCACCG
ACAAGCCCAGCTTCTGTATCGACCAGCGCCGATGGCGAGATGCCGGCACCGGAGAAGGAAAAGAAAAAGGCACACCGCGG
TCGTCGCGGCGGTGCGAAGCACCGCAAGGGTAACAAGAACAAGGTAGAGACGTCGCAGTCTCGGGGCGATGAGCCCGTTG
CTCTGGCCACGGTGGACGAGGTGGTGGGACTGGCCAAGGAGCTGGGTGAAAAGCGGCCAGGGATGGAGCCGGACATTCTG
ACGGTGCCGAGCAACGTGCAGGAGGTGTCGGGTCCAATCCTGCGCATGGGCAGCCTGGAGGTAGACGAGGACCAGCAGCT
GGGCACGGGCAGCAACGGGACGATCGTGTTTGCCGGTCGGTTCGACGGCCGCGAAGTTGCCGTCAAGCGTATGTTGGTGC
AGTTCTACGACATTGCGTCCCAGGAGACGAAGCTACTGCGCGAGAGCGACGACCATCCCAATGGTGAGTTTCTTTGGATG
TGTGCGTGTATGTTCTGCGTGCTAACCCTGCAGTGATCCGTTACTTCGCTCAGCAGCAACGGGCTGCATTCCACTACATC
GCGTTAGAGTTGTGCGAGGCATCCCTGGCCGAGGTGATCGAGAAGCCGTTCGCATTCCGGGAGCTGGCACAGGCTGGCGA
GCGCGACCTGCCCAACGTCTTGTATCAGATTACGAGCGGACTGAACCATTTGCACTCGCGCAACATTGTGCACCGCGACC
TGAAGCCACAGAACATCTTGGTCAACAAGGGCCCCAACGGCAAGCCGCGGCTGCTGATCTCGGACTTTGGCCTGTGCAAG
AAGCTCGAAGGCGGACAAAGTTCCTTTGGGGCGACGACGGCCCATGCGGCTGGCACGAGCGGCTGGCGGGCGCCGGAGCT
GCTTCTGGACGACGATGCGCGCGACAGCGGGACGACACTGGTGGAGGCCATGTCAACCCAGAGCGGCGGCTCGCACGGGC
TGCTGGCTGGCCACGGCGAGGGACAACCGCCGATGAGACGAGCAACCAAGGCCATTGACGTTTTCGGGCTCGGGCTTGTT
TTCTTCTACGTCCTGACTAAGGGCTCGCATCCGTTCGACTGTGGCGACCGGTACATGCGCGAAGTCAACATCCGCAAGGG
CAACTACAACCTGGAACCGTTGGGGATGCTAGGCGACGTGGCACCCGAAGCCAAGGATCTGATCAGCCACATGCTCCGGG
CGAACCCACGACAGCGGCCGCGGACGCGCGAGGTCATGGCCCACCCGTTCTTCTGGCCGCCCAAAAAGCGACTCGCCTTC
CTCTGCGACGTGTCGGACCACTATGAGAAGGAACCGCGCGACCCGCCGTCGGAGGCGCTGTTGCGGCTCGAGAGCCGCGC
GTCCGAGGCCGTTGAGGGTGATTTTCTGCGTCAGCTGCCACGCGACTTTGTCGACTCGCTCGGGAAGCAGCGCAAGTACA
ACGGTACCCGCCTTCTCGATCTCCTACGTGCCCTCCGAAACAAGCGGAACCACTACGAGGACATGACCGAGCCGCTGCGC
CGCCTGGTTGGGTCGCTGCCCGAGGGCTACCTCAACTTCTGGGCTGTCCGCTTTCCCTGCCTGCTGCTCGTCTGCTGGAA
GCTCGGCTTCGATGAGGACTGGGAGGCGACCGACCGCTTTACCGAGTACTACCAGCCGTCGGCGGGAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62