GenePrediction:GLEAN_4276 Details

Name: GLEAN_4276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1000061..999120 (- strand)
Length: 942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1000061..999900 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_179:999818..999120 (- strand)
Length: 699
>GLEAN_4276 class=GenePrediction position=GCSC_179:1000061..999120 (- strand)
ATGTCAAACCAGATCGCATCCCCCGTTGTCGACGCGACGGGAAAGACTAAATTACGTGCTGCGCTTGAACGAGCGAAGAG
ACGTGAAGGTCCCTGTGTTGGACAACGGCTTGAGCTGCCTGGATACACGTTGGCCAAGACTCTGGCCACCTTGGGCGAAG
ACGTGGGTTCCTCTAGCGGATTGCTGTCCGGTGGATGCTTGTCATCTAATACCTCCAATCTAATGCCTCCATTGTGAAGA
TAGTGGGTTCTCATCGATGCCGAGCATGGTAACATTGACGATAGTGGCATGTACCTCCAGGTTGCAGCCGTGTCTACGTC
AGGTGTATCGCCGATTGTCAGAGTACCCGCGTCAGAGGCGTGGATGCTAAAACGGGCATTGGATTGTGGAGCGCATGCGA
TTATGGTTCCTATGTGCGAGACAGCGGAGCAAGCACAAGCCATTGTGCATGCTTGCAAGTATCCCTCGTCCAAGTGGCCA
CAAGGCGTCCGCGGTACAGGAGCCATGCACGCCCATACCGCCTTTAACCAGACTGGCCGGGATTACCTGTTAACTGCAAA
CGACAATGTCATGATCTGTGTACAGATCGAGAGCAGGCGCGAAGTCGAGAATGTCGAAGAGATTGCTGCTGTCAACGGCA
TTGACATGCTCTTCATCGGTCCCAACGATCTAGCCTCATCCCTGGGATACGTTGCGTTTGACCATGCGACAACGCCCGAG
GTTCAGGAAGCATCGGCGCGGATCTTGAAAGCTGGCTTGGCGGCTGGCAAATATGTCGGGCATTTTGCCTTGAGCGCCGA
GGCGGCTGCAGCCAAGTACAGGGAGGGTTTCCACTTTGTCAACTGCGGGGCAGACATTGTGGCCATAACCAGCTGGACGA
GCAATGAAACGGCCAAGTTGAAGGCCTTGCTCGCAACAAAGGATGTCAATGGGACTAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62