GenePrediction:GLEAN_4277 Details

Name: GLEAN_4277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:996857..995577 (- strand)
Length: 1281
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:996857..996562 (- strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_179:996491..996261 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_179:996201..995819 (- strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_179:995644..995577 (- strand)
Length: 68
>GLEAN_4277 class=GenePrediction position=GCSC_179:996857..995577 (- strand)
ATGCCGGCCGACGCTACTTTCCCAATCTCTAAACGGGCCGTTGTCTGGGTCGGGGCACGAAAGTTGGAAATTCAGCAGAA
GCCCGTCAGAATTCCCGGCGACGATGAACTGTTGGTCAAAATAATGGCCACGGGCATCTGTGGCTCTGACTGTCACAATT
GGGAGAGCGACAAGGTGTCTCGTCAACTGATTTTGGGTCATGAATCTTCGGGTGTCATCGAGAGGATTGGCAAGAGTGTC
CAGGATCGAAAGGTGGGCGATAGGGTGGCTGTGGAGCCAGGCTTTCCCTGTTTACAGTACGTGTTGTGGAGTTATGAGGA
AGCGGACGTTCCGTCTCATTGCCCTAAGCACTAACTTCACCAAAAGGTGCGAATTCTGCCTTCGAGGGTCATTCAACATC
TGCGCCGAATTGAAATACTGCGGTCTTGATCCTACGGACGGAACGTTGTGCCAGTATTTCGTTTGCCTGGCGTCCATGAC
GGTCCCAATACCGGAAAATGTCTCCTGGCAAGAAGCCGGCGGGATTCAGCCTCTCGCTGTCGCCGTGCAGCTGGCACGTA
GAGCTGGTCTGAAGACTGGTCAGACTATGGCTATATTGTAAGATATGATGTCGTCTTAAGCTATTGCTATCGTCCACTGA
CGGCTGTGGCACGTAGCGGTTGCGGACCTCTCGGTCTGCTCGTCCTCGCTGTTGCTCGAGCATATGGGGTCCAAAAGATT
GTCATGTTCAATATCGAGGAGACCCGTGCCAAGTTTGCCGAGTCGTACGGTGCCGACAAGGGGATTGTGGTGTCGAGGAA
CACAAACCCGGACAAGGATCCTCTGGCGTTTGCGCAGGAGTATGCCAGCCGGATCATTCTCGAACAAGGAATCGGACACG
GCTGCGATGTTGTTGTGGAGGCGAGTGGGGCAGCTGTCTGCGTGCTTATGGGCATCTGTATGCTCAAGGCTGGAGGCACT
TTGATTCAGGCCGGACTCGGAAAGCCATTGGTTTCTGTACCATTGTTTACCGTGACGGCCAAAGAACTCAGCATCAAAGG
TATGTGAATGCCCTGCTGAAGCAGATGCCTAGATCTGTCGTTTCCCCTCTGCTTACTCTTTCCAGGGACCGTAAGATATA
CAGCGGGCTGTTTTGCAGAGGCCATTGGACTCTTGACAGACAAGACAGTTGACCTGAAGCCTCTGATCACATGCACATAT
CCCTTGACTAAAGCCTCTGAAGCTTTTGAGGCACAGCATGCACGATCGAATATTAAGATCATTATACTGAACCAGGATTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62