GenePrediction:GLEAN_4278 Details

Name: GLEAN_4278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:985550..984066 (- strand)
Length: 1485
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:985550..985230 (- strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_179:985165..985060 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_179:984998..984666 (- strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_179:984607..984066 (- strand)
Length: 542
>GLEAN_4278 class=GenePrediction position=GCSC_179:985550..984066 (- strand)
ATGTTGCTAAAAGTTGTGTCCATTCTTGCGGCTGGCGCCTTTGGGGCTGCCGAGGCTTCCCTCCGGAAGCCTGTTGTCCA
GACAGGCCTAGATGTGCTCATCCGTTCAAGCTACAGCGCTCTACATGGCAAGAAGGTCCTGGTTTTGACCAACCCCACAG
GCATTACACCCGACCTCGATCTTGGTGTGGATGTCATGGTGGAATCTGGATCCGTCGATCTGGTCGGGGTCATGGGCCCT
GAGCATGGCTTTCGCGGCACATCGCAGAATGGAAACGGAGAGGCAACATTTGTTGATGCCAAGACCGGACTCACCGTCTA
CGTGAGAATGCCCATCACTATGGGGAAGAGAGCCGAGCAAGCACAACTGTATCTAACCCGGACAGGACGCATACAATGTG
AACACCACGGTGATCCAGTCTTACATTAAAGAGTCAGGAGCAGACACCCTTATGTTTGATATCCAAGACGTGGGCGCCCG
TTTCTACACCTGTAAGGCACACTTTGGCGCATATCTGTGTACGTGCAGAATGGCTGCTGACACACGCATCAGATACCTGG
GCTATGTACGACAGCATGGTTGCTGCTGCTATGAGTAACATTTCCTATGTTGTTCTGGATCGACCCAATCCTATCACCGG
TCTGAATGCTTTTGGGCCCGTGCTTAACGAGAGCTTTGTGAACTCCTATGTCGGTCGCCGTGCCATCGCACAGGCACATG
GCATGACGGCTGGAGAAATGGCCAAGATGTTTGTCGGCGAGGGCTGGATCAAAGAGTCGGCAGGCGGCCTGGATCTCCCA
TCGCTCAATGTAGTTGAGATGAAGGGCTGGAAGAGGTCGATGGACTTTGTCGACACGAAGCTTCCCTGGGTTCTCCCAAG
TCCGAGTGAGTTCTAAGCTCTGCCAGTACAACGGGTCGAAGATAACTAACCCGTGTGACGCAGACATGCCGACGCTTGAT
ACGGCCATGCTGTATCCCGGGACCTGCATGTTCGAGGGAACCAGCATCTCCGAGGGCCGAGGAACGGCTCGTCCATTTGA
AATTATGGGCGCGCCGTGGACGAACGAGAGCTGGACAACGGCCATGAGGGACCTTCAAATCCCCTACACTGACTATCGCT
TCCAATGTTTCACGCCCACTACATCTAAGTTCGATAGCACGATATCCTGCGGCCTGCAGACATACATGGCCGTAGAGACT
GACTATGCGCATTCAACATTCGATCCTGTCTATGTCGGTGTCGGTCTTCTCTGGACTGCTCGCCACCTGTATGCCAACGG
GTCAACGGAGCCGAACGAAGGCAACTACACTGCTAGCTTCCACTGGAGACAAAATGGCGACTATTATGATATCGATCTGC
TCGTGGGTAGCCCCTTGATTCGGGAGGGGATTGAGACAGGGCTCCATCCTTCTCAAATTAAGGCGGCGTGGAAGGGCGAG
CTTGATCTTTTTAAGAAGAGGAGGTCCAAGTACCTTCTGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62