GenePrediction:GLEAN_4280 Details

Name: GLEAN_4280
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:969326..968142 (- strand)
Length: 1185
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:969326..968142 (- strand)
Length: 1185
>GLEAN_4280 class=GenePrediction position=GCSC_179:969326..968142 (- strand)
ATGTCCACCACTGAATTCATCTCCGTGACCTTCCCCAATGCCTCCACGGAGCTGCACCCGCTCCCAGACGCGGCGCCCGT
GGACCCCGAGTTTATCGTGCGGTACTCGCGTGCGCTCGATGACTACGGCTACAACTACACGTTGATCCCGTACGGGTCCA
GTTCGTTTGACCCCTTTACCATCGGCGCGACAATCCTGGCCGTAACGAAGAAGATCAACGTGATCATCGCACTACGGCCC
AACACGATGTACCCGACGGTAGCGGCCAAGGCACTGGCCACGCTGGACCGCTTGGGTGGTGGTCGCGTGGTGGTACACTT
TATCGCGGGCGGCAGCGATGCGGAGCAGGCCCGCGAGGGTGATTTTCTGGGCAAGGAAGAGCGGTACGCGCGCGAGGAGG
AGTACATCCGGATCCTGAAGCGGGCCTGGGCCTCGGGTGACGCTTTCGACTGGGAGGGCAAGTACTACACCTTCAAGGAC
TTCCACCTGGCCGTGCGGCCGGCCGCCGGAAAGATCCCCATCTCAGTGGGTGGCTCGTCCGAAGAGGCGTACCGCGTGGG
AGGGTCGCTGGCCGACATTTTCGGGCTCTGGGGCGAGCCGCTAAAGGAGACGAAGGAGCAAATTGACAAGATCAACGCTG
CTGCCGAAGCTGCCGGCCGCACTGATCGGCCGCGCATCTGGGTAACCTTCCGGCCGATCCTGGCCGAAACCGAGGACCTG
GCCTGGAGCAAGGCCTATCGGACCCTTGACCAGCTTAAAGCAAACTCGGCTGCTTTACAACAGTGGGGGGAGCAGGCTAA
GAAAAGCACGTCTAACGGCACGTCTAACGGCACATCAAACGGAGAGGCAAAGGCTGTTCCTCCCCAAGGTGCCGCCCTAA
AGCAGGAGTTTAGCGAGCCGCAGAATGTTGGCTCCCAACGGCTACTTGCCATTGCCAAGCGCGGAGAGGTGCAGGACCGC
GCTCTGTGGTATCCCACCGTGACTGCAACCAATGCGCGGGGAGCGTCCACAGCTCTGGTAGGATCTCCCCAGACTCTGAT
CGATTCCCTTTTGGACTATGTCGACCTGGGCGCCTCGCTTATCTCTATCCGCGGCTATGACAACCTCAATGACGCCATTG
ATTACGGTCGCTACATCCTCCCTGGCATGCGGGTAGAGTTGGCCAAGCGTGAATCAACGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62