GenePrediction:GLEAN_4286 Details

Name: GLEAN_4286
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:915596..914355 (- strand)
Length: 1242
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:915596..915527 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_179:915459..914705 (- strand)
Length: 755
Type: CDS
Source: GLEAN
Position: GCSC_179:914657..914355 (- strand)
Length: 303
>GLEAN_4286 class=GenePrediction position=GCSC_179:915596..914355 (- strand)
ATGGCGGCCTTTCCTCCACCACCAGCAGCTACGATCGACTGGGCCAATGGTGGGTTCCGCGTACGCGAAGGTATGTCGGG
GAGTGCTGGCCGTGTCTGGGCGTTTTTCGAGGCCGTTTTAACAGACTTCTTTGGCAGTCAACGGCCACGTGGAGTCGCAC
TACACAAAGGAAACAGGCCAGTGGTCAGCACCGGTGTTTGTGGAGGATCCGTATGTGCGAATCCATGGGATGGCGCCGGC
GCTCAACTACGGACAGCAGGCGTACGAGGGTCTGAAGGCGTTTCGGACGCCTGGTGACCAGGGGATCCAGATATTCCGGG
CGGACAAGAATGCGGAGCGGCCGCAGCGGTCAGCGGAGGTGATCTCGGTTCCGGCGGTGCCGACGGCGCTGTTCCTGGAC
GCGGTGCACGCAGCGGTGGCGCGCAATGCAGAGTTTGTGCCGCCACACGAGACGGGGGCGGCACTGTACATCCGGCCGCA
GGTGTATGGAACGAGTGCGCAGCTGGGTCTGAGTCCGCCAGAGGAGTATGCCTTTCTGGTGTATGTTCTGCCAACGGGAG
TGTACCATGGCACGGCGCCGGTGCGGGCGCTGGTGGTGGACGATTTTGATCGCGCGGCGCCTCAGGGAACCGGCCACGTC
AAGGTAGGCAGCAACTATGCGCCAGTGCTTCGATGGAGCGAGCAGGCGCGGCGTGACGGCTACGGCATCACGCTGCATCT
GGATAGTGTCCGACACGAGGACGTGGACGAGTTCAGCACGAGCGGCTTTATCGGGGTGAAGAGGGGCGACGGTAACGACG
ACATCACGCTGGTCTTCCCCGACAGCCAGTGCGTCATTGCAAGCGTCACCAGCGACAGCGTGCAGAAGATAGCCGGCCGC
TTCGGCTGGGCGGTTGAGAGGCGCCAGTCCAATATGTCGAGCTGCCCACGTTTGCCGAGGTGCTGGCCACCGGCACGGCC
GCTGCCTTGGTGCCGATCCAGTCCATCACGCGACGCATCGACAGCGGCAGCCCGGGCTCCCTTGCAGCAGCCCAGCCGTC
GCTCCGGTCGCATCCACGCGTGCGGCTGGACGGCAGCGGCGAGGAGACGATCACGTATCTGCCGGCAGACCAGCCGGAGG
CCGGACCGGTCTGTCTGCGGCTGCTGGCACAGCTCAAGGGCATCCAGCAGGGCTCGGTGGTAGATCCGTTCGGCTGGGTA
ACGGCGGTGACAGCATCAGATCTAAATAAGGCGGGGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62