GenePrediction:GLEAN_4288 Details

Name: GLEAN_4288
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:876723..876394 (- strand)
Length: 330
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:876723..876394 (- strand)
Length: 330
>GLEAN_4288 class=GenePrediction position=GCSC_179:876723..876394 (- strand)
ATGTCCAATCAGACTACTGCCACTTCGGCAGATCTTCGCACTTCTCTTTCATCGGAAATAGCCAGCACGAAGCTCCAAGC
TCCAAGCCCCGACACAGTTGCGCATTCCACGGAACCATACGCCGACTTGCGCGCTGCCCTTGTAGCAGCTCGCGATTTTC
TCTCTGGCAATGTTTGCCTTCATGCAAACCTCGCCGTCTTTCTCATCGAGGCCTCAAGCTCAACCCTTGAGAATGTAACC
TCAGCAGCTAAAAACAACAATGATGCCCTATCTCATATTGCTGCTGCTATTGCCATGCTGCCGGACCCACGAGGGCAAAC
GATCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62