GenePrediction:GLEAN_4289 Details

Name: GLEAN_4289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:875616..874687 (- strand)
Length: 930
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:875616..874687 (- strand)
Length: 930
>GLEAN_4289 class=GenePrediction position=GCSC_179:875616..874687 (- strand)
ATGGGCGACCACAGCCAGGCGAGGCCACAGGGCTACATTGTCCGCATCGAGACCAAGCAGGGCTGTGTCTACCGACCCAA
GACACCCACCGAATTGCCGACCCCCGGCGGCCAGCAGCGTCGTTACCGCTTTCCCGTGGCCCCGCATATGGTCGTGCAGA
CCGTCAGCAGCTCGGTGCAGTCGTTTCCCCAGGGGAAGAACAAGACAAGGCTTGGTGGTAGCGCTGCAGGGCCGGCACAT
CCACGCATCGGCGACGACTCCATCGAGCTCGGCATCGATCTGGCCCGGTCGGACGTGCCGCTGCCGGGCGAGAACCGATC
AGTGGCGCCGCTTTACACCTCCGAGGCTGAGCAGGATGCAGAGTTGTACCGCCGAGGAATACTCTACCATGACGGCACTG
CGGGTGAAGCCGGGACACCTCCAGCTGTGACAGTAACGGCGGCAAACACCTCGACTGGCCCGGCCGCCTACCAGGCTGAC
AGCTTAGACGGCATCCGTCACACGCAGCCGGCGTACACGGTGCGTCTTGTCGATGGCAAGAAACGCAGGGGAAGGAAGGC
TGCTGCGGCTGCTGTTGAAGCTGAGGCTGAATTCGATATCATCACTGACGTTGACACTGATGTCGGCGCCGGCAGTGCTC
AGCTCACAGAGTCATCAGACAAGAATGGTGACGAGGAAGCAAAGCTGATCAAGGAGCTCCCCATTCCAGAGGGTCTGCGT
CTGTTCACCCTCGGTAACCTGTGGGAGGAAGAGAACCCAGATGCGGCCGCTCACAGTGATGCAACCAACCGTCTGCTCGG
CCACGAGGACATCAGCCTGGACGATATTGAGAATGTGGAGTATGTTTTGATCGATGACGACGACCTGCATTCGATGGCTG
CATCATGGGTGGAGCTTGACAGTGTTGCGGAATCAGACGACTGGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62