GenePrediction:GLEAN_4292 Details

Name: GLEAN_4292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:847674..847000 (- strand)
Length: 675
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:847674..847346 (- strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_179:847276..847167 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_179:847103..847000 (- strand)
Length: 104
>GLEAN_4292 class=GenePrediction position=GCSC_179:847674..847000 (- strand)
ATGTATTCCATCCCTATTTGCCGCACGGCAGTTCGACTGGCCGCCGTTGCCCTGCTTTCCTCTTCTGTCCGTCTCGCCCA
TGCTGCTCCGGCTGCGGTGGAAGCTCGCGCTCTGTACGGCCGGGCGATCTCGTTTGCAGAGTCCTGCACCGACATTGCCT
ACTTTGGCTACTGCCGGGTCGAGGCCACGTGCACTCTAGACGGCAGCGCCATCTCGACGGACGCCGAGACGCAGCATACG
ATTCTCGATCTGGGCCAGTGCATCGGCTACAACAAGTCGACAGAGCAGCTGACGTGGCGCTCAAAATCCGTGTCACGCTG
GAATATGGGGTGTGTGACCGCTGAATCCTCAAGCCGTCCGGCCATTCTTTCTGATTGAAACACTGACCGATCGAACAGCT
ACTGCGCGCCTTGCAGCCAGTGCACGATTGACCCCGACACGACCGAGATGACTTGCGACTGCTCCTACGTGCTCCAGAGT
AAGGACCACACGTCGCAACTGTTGCTGAGTATGTACCTTGTTAGCAAGATTCTCCGCAAGACAAACAAGCGAGACTGATG
GAAGACAACAGGCGACCATGTCTACAACCACGAAGGCCTGCTCAGCTGCCTTGACGTCATTGGAGATCCAGATCCGAACT
ACTCCATGAAGACAACAACAGCATCGACTGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62