GenePrediction:GLEAN_4293 Details

Name: GLEAN_4293
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:834611..832581 (- strand)
Length: 2031
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:834611..834435 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_179:834384..834280 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_179:834222..834200 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_179:834132..832581 (- strand)
Length: 1552
>GLEAN_4293 class=GenePrediction position=GCSC_179:834611..832581 (- strand)
ATGGGCTCCGTAATTGAAAACGTCCCCGACGCCTCCATCAAGGATGTCGTGAACGACATCTTGTCGACCCAAGTTCCAGT
TGCACAGGAACGGTCGATCAATCCGGCGTTGGCGGCGCGCATTGCTGCTAGGCACACTCCAAAACAGAAGACGTGGCGGG
AAGACCGGCCCGTCACGGTGAGCATATACCGATAGAGGAAATTGTAACGTTCGCTGAGGCCAGATAGATCATCGTTATTG
GTGCTGGCATTGGCGGCACAACTACAGCCGTGCTGCTATCTCAAAAGGTTCCTAATGCGACCATCACGGTGTATGACCGA
TTGGACAAGATTGTGCGTAAAGCTCGCCAGCGATAACAAAAGCTCCGTGTCTGATACTAACGCGTCCAGGGCGGCACATG
GGCAGCCAATGTGTAAGTAGTCCCAGCGGGAGACTGTACGGGAAAAGGCGTCTTTGCAGCTGACGACGGCCGAGGGAAGT
TATCCGGGCGTGCGGTGCGACGTGCCATCGCACGTGTACCAGCTCAGCTTTGAGCCCAACCTGGACTGGTCCGAGTACTA
CCCCAAAGGCGCTGAGATCCAGCAGTACTACGAGCGCGTGGTGGCCAAGTACGGCCTGGCAGAGCGGTTCCGGCTGGGCC
ACGAGGTAGTGCGGGCCAGCTGGCTGCCGGCGGCGTCGCAGTGGGCAGTCGAGGTGCGCAGTCTGGCCACGGGCTTAGTC
TCGGTGGACACGGCCGACTTTCTGGTCAGCTCGCAGGGACGCATCAGCGAGCCGAAGTGGCCGGCGATCCCGGGCTTGGC
CGAGGGTATCTTTGGGGGCCGGACGGTACACTCGGCACGATGGCCAGCAGACCTGGTGTGCGAAGGCAAGCGAGTGGCGG
TGATCGGAGCCGGTGCGAGCGGCCAGCAGGTGGTGTCGAACGTGTTGAGATCGGCCGGCCACGTGGACCACTACGTGCGC
ACCAAGACGTACATCTCCAGCTCGCTGGTCGGCGACTTTGACGAGGCCACGGCAGACGCACCCGGTGGCCATGTCTACAC
GGACGAGGAGCGGAGGACCTTTCACGAAGAGCCGGGAGCCTACGTGAGCTTCCGGCGTGACCTCGAGCTGCGCATGCAGC
GCCGTCGGCTACAGGGTGCCAATGTGATAGACCACCCAGCCAACCTGCAGCTGCGTGAACGCGTGGTCGGACGCATGCTC
GAGCGCCTCGACGGCGACGACGCCTGGCTGCACCGCATCACGCCTGACTACGTGTACGGTTGCAAGCGGCCGACGCCATC
ACCGGGTTATCTCGAGGCGCTCCGAGCGACGCCTGCGGTGCTCTCATACATCACCGACAGCATCGTGTCCATCGATGCGA
CCGGCATCGTCACTGCCGACGGCATCCACCGTCCGGTCGACGTCATCGTGGCCGCCACCGGCTTTGAGAACGGATACACG
ACGCGCTTTCCGCTGATCGGCCTCGACGGCGTCGACCTGCGCGATCGATGGGGACCCGACAGCCCTATCGGCTACCCGGA
GTCGTACCTCGGTGTCATGGCCCCCGGCTACCCCAACTACTTCACCGTGCTGCAGGCTCAGGCCAACGCTCTCGGCGGCT
CCGTCCCGCTGCAGGCTGAGATCACGGCCACGTACATTGGCAAGGCCATCCGCAAGCTGCAGTCGCAGAGCTACAGTGCC
CTTGATCCGCGCCAGGATGCCACCGATGACTTCAACAACCTGATTGACGGCTTCTTCGGCAACAAGACCATCCAGGGCGA
GTGCCGCAGTTGGAGCAAGATCGGCTTCGGCAAGGGCCGCGTCGTGTTGGCTTGGCCCGGCAGCTTCCAGCATCGCGTCC
GAGCCCTGCGTGATCCCCGCTGGGAGGACTTTCGCTTTGTCCGCCGCCCCGACGCTGCCGCCAACCGCTTCGAGCACTTT
GGCAACGGCCTCACCGACGTCGACGAGAGCGACGACGACGTTTGCCTGACTAGCTACCTGCGCGAGTACGGAGAGCTGGA
CCCTCAGCGGCACCATGAGTATGCAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62