GenePrediction:GLEAN_4294 Details

Name: GLEAN_4294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:831458..830548 (- strand)
Length: 911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:831458..830858 (- strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_179:830795..830548 (- strand)
Length: 248
>GLEAN_4294 class=GenePrediction position=GCSC_179:831458..830548 (- strand)
ATGGATCTCAAAGCCGACCGTTCACTCAAAGGCAAGGTTGCCATAGTCACTGGGGCTGGCTGTGCTGGCGAGGGCTTTGG
AAACGGCCGTGCCACAGCTTACTTGCTTGCAGAGGATGGCGCCACCGTCATCTGTGTCGATCGGCAGCTGGATTGGGCAC
AGAAAACGGTCGAGTATATTGAGACCTATGCCAAGGGGACTGCAATTGCATGCGCTGGCGATGTGACGTCGGAAGAAGAT
GCAAACCGAATCATTCAGACAGCGATCGATACGTTCGGTCGCCTGGATATCCTCGTCAACAACGTCGGGGTCGGGGGCTG
CCAAGGATCTGCGGTAACGCTCGATGTCAAGGCCTGGGAACGAGATATGACGATCAACGTCTCCAGCATGGTCATCATGT
CCAAGTACGCCATCCCCGCTATGCTGAAGAACGAGCATAGGCTCAAGGGAAGCATCGTGAACATATCTTCGGTCGCAGCC
CTGAACGGGGGGATGAAGAACCTCTTGTATCCGACTTCCAAGGGCGCAATCACGGCCATGACAAAGAACATGGCTTACCA
GCACGGAAAGCAAGGCATTCGAGTCAATTGCGTTTGTCCTGGTACGTTCACGGCCTAGTCCCCATTATATATGCACCATA
GACTGATTGCGGATTGATATTAGGCTCGGTCTGGACGCCTTTGCTGTATGAGCATCCCGTCCTGTCCGGAGACACAGACC
TCAGCGATAAGGTACGGAAGACGCGTGCAGAAGGGAACATGCTCGGAACTGAAGGATATGGCTGGGACAGCGGCTATGCA
GTGCGCTGGTTGTCAAGCCCGGAGGCAAGATGGGTGACAGGAGTGGTTCTTCCTGTTGATGCTGGTCTCTCTGCAACCAT
CCAACTGGAAGTGCCAGAGACGAAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62