GenePrediction:GLEAN_4295 Details

Name: GLEAN_4295
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:815678..814137 (- strand)
Length: 1542
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:815678..815655 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_179:814310..814137 (- strand)
Length: 174
>GLEAN_4295 class=GenePrediction position=GCSC_179:815678..814137 (- strand)
ATGGTCGAGGTCGAGCACGGCACGGTAGAGGTGGTGGTGGAGTAGACGGTCGTCACAAAGGTCGAGCCGCTCGACGTCAC
CGTCGCTGTGGTGTACGGGACGGTCGGAACGGTCGGGACGGTCGACGTGGAGTAGATGGTGGTCACAAAGGTAGAGCTGC
CCGAGGTGATGGTAGACGTGGTGCAGGGTGCTGTGGTGGTGGTCGAGTACGTGATGGTGGTCAGGTACGTGGAGCCGCTC
GAGGTGACGGTCGAGGTGGTGCACGGGGCCGTGGTGGTGGCCGTCGACGTGATGGTGGTCACGTAGGTCGACCCGTTGGA
CGTGACGGTGGCCGTGGTGCAGGGAGCCGTGGTGGTGGTCTCGAGGGTGATGGTGGTCACGTAGACGGAGCTGCCCGAGG
TGACGGTCGACGTGGTGCACGGCACAGTCGACTCGGACGTCACTGTCGTCGTCTGGTTGAAGTACGGTGCCGTCGTCGGC
GTGGTGACGGTCCAGAGCGTCGTGCCGGGAGCCGTTGTGAGGGGGACGGAGATTGTAGGCGTGATGGTCGACGAGGCGGA
CGAGGAGGCCGAAGACGTCGTCAGGGTCCAGACGGTCGAAGGAACAGGCGTCGTCGACGGTCCGGTGGAGAGGGGCACAG
ACGGCGTGTATGTCACCGTGGACAGCGTCGACTTGGGGCCAGTGGACAGCGGCACGGAGACGGTGCTGACTACCCAAGTG
CTGCTGGCCGGGCTGCTTACCGGCACAGAGCTCGTCGCCGTCGACTTGGTCTTGGTGCACTCATGGCAGGGAACGGTGTT
GGTGGTGGTGTAGGTGACAGTGTAGGTGGTGCCAGACGAGGTGTAGGTCGAGCAGCTGGTGGTGGTCTCAACGGTCGACG
TGACGGTCACGTTGGTCACCGGGACAGTGGACCAGGGAGCCGTAGTGGGAGCAGTGGTGGGAGCAGTGGTGGGAGCAGTG
GTGGGAGTGATCGGAGCCGTGGTTGGGGCAGTGCTTAGAGGAACGGTCGGGATGCTGCTGGAACTGGAAGACCAGACGCT
AGGAGTGCTGCTGCTCGCGACGGATGTGGTAGACCAAACGCTAGGAGTGGTGCTCGCAACAGACGTGGACCAAACGCTGG
GAGTGGTGCTGCTCGCAACAGACGTGGACCAAACGCTGGGAGTGCTGCTGCTCGCAACAGACGTGGACCAAACGCTGGGA
GTGCTGCTGCTCTCAACCGTCGACGTAGTAGACCAAACACTGCTGCTCGGAGTGCTGCTAACCCACGTGCTGCTGCTCGC
CGGCACGGTCGGGACGGTGGCGGTGGACTTGGTCTTGGTGCACTCATGGCACGGGATCGTGTTGGTGGTGGTGTAGGTGA
CGGTAAAGGTAGTGCCGGACGTGGTAAAGGTCGAGCAGCTGATGGTGGTCTCAACAGTGGCCGTGACGGTCACGTCGATC
TCAGGCGTCGTCGTCCACGGCGTGATGGACGAGGGCGGCGCCGTCGAGGTGGTCTCCTCGATGCTCGACGTCGGCGGCAC
GGTGGTGGTGGTGTTGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62