GenePrediction:GLEAN_4296 Details

Name: GLEAN_4296
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:806167..805431 (- strand)
Length: 737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:806167..805979 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_179:805902..805591 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_179:805478..805431 (- strand)
Length: 48
>GLEAN_4296 class=GenePrediction position=GCSC_179:806167..805431 (- strand)
ATGCAGATGCTGTCCCGTCGAATTGTCAAGGCAGCGCCCTTGCGCCAGGCAGCCCTTGCAGCTACGCGCAGGCTCGCACC
TGTCGTCCAGCAGCGCACCTACATCCCGAACTCTATGAACAGCGTCGAGGTCATCAACGAAAAGTTCCCTGAGCCTCCGA
GCCTGACCGAAGCCGAGGATCCGGCAATGGTAAGTGCACGATAGAAACCACCAAAAGGGCCGCCGATAAACCGGCAGACG
CGGGCGGGCGTACTGACAGCCGCAGAACGGTGGTGTCGCACAGTCACCCCCCATCAAGCGTCAGTTCCGCGACCCCCACG
CCGACTGGTGGGACAAGCAGGAGCGCCGCAACTACGGCGAGCCGGTCCACGAGGACTACGACCAGCTCGGCATGCTCACG
CCATTCGAGTACACCTGGACGACGCCCGGAAAGGGCCTGCTACAGATCGGTGCTTTCGTTGCCGTGTTCCTGAGCGTCTG
CTACACCGTCAAGCTGACGCGCCCCGACCCAGTCGCCGTTCCGCGGGAATTCGAGGACGGCCTTCTGAAGGAGCTGGGCG
GTGCCGGTGCTGTCAGGGTAAGTTATTTTGACGTTATAGGAACCGGATGAGATGCGTAGGCCGAGAGGCATAGGCGCAGA
CTGTGTCCTTTCTTTTCGTTTTCGTATTGATTGCTGATATATTTCACAGGCGAGAAGCCCCGAAGACGCCGAGGCCGAGT
ATGCAGAGGAACTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62