GenePrediction:GLEAN_429 Details

Name: GLEAN_429
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1708878..1710939 (+ strand)
Length: 2062
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1708878..1709578 (+ strand)
Length: 701
Type: CDS
Source: GLEAN
Position: GCSC_167:1709643..1710548 (+ strand)
Length: 906
Type: CDS
Source: GLEAN
Position: GCSC_167:1710627..1710939 (+ strand)
Length: 313
>GLEAN_429 class=GenePrediction position=GCSC_167:1708878..1710939 (+ strand)
ATGGCATCCACCGTCAAAGGAGATAATAAACCGTTGAGTACCCGGATCGAGGAGTACGAGGCACATCGCAAGGAAATAAT
CGACGAAGAGGATGGTGTTGCTTTTGACTACGCATGCAAAAAGAATGCAACTGCTGCCGAGATACTGGCTGATGCCGTGA
TAAGGAAACTGAAGACGGATGATAAGGAAGCCTTTTATGATTCGGCAGCCACGAGAACAGGCTTTGGCAGGCAGGAGCAT
CCGCATTTCCCAGGCGACCATTTCCTGACAAATGAGCCTATTATCGCTAAGACTGAACTGCTAAAGGTAGCCAAGGCGAT
GCCGAAGGGCGCACATCTGCACATACACTACAATGCCTGTTTACTACCAACCGTGCTGTTGGAGGTGGCCAAGGGCATGG
ATCGCATGTTCATAACGAGCGATCTACCGCTCGTGTTGACCAAGACGTCCGAATCAGACAGCTTGGTCGGCACCGAGAAT
TTCTTCCTCTGCGAAATACAATTTTCTATCCTGTCCAACGAAAAGGTGACCGACCCGGGTGACATTTTCAGCCCAGCCTA
CAAGCCGCGCCAGACTATGCACTTCAAAAAATTCTTGAAGCGCTTTCCTAGCGCGTTCGGCACCCCGGCCATGGAATGGC
TGGCGTCGAAGCTGGTCTTCTGCGAGGAAGAAACCTACGACATCCCTCAGACGTCGAGAGGGTAAGCATACGTTGAGCAT
TCAAAGCGAGCAGGAAAAGCGAATCGAGCTGATACAAAGACACAGGGCCTGGGAGCGTTTTAATGGACGGACGCGTATGA
TGAAGGGACTCTTCAATTATGCGACTGCATACCGGGAATACACAAAAGCTTTTTTAGAGAATCTTCTGGAAGACAATATA
CAGTACGCAGAGATACGGCCAAACTTTATGCCAACCAACCACCTGTGGAGCGACGATGGGACGAAGCAGATCACCAACGC
TGGCATCATCGAAATAATCATTGAAGCATGCAAGGCTTTCAAGGCGCGAAAGGAAGATGAGAGGAATAAAGCTGAGCAGA
AAAAAGCCAAGCAAGACAGAGCCGAGAAGGACGGAGCCAAGCAGGACGACAAGCAGGACGACAAGCAGGACGACAAGCAG
GACGACAAGCAGGACGACAAGCAGGACGACAAGCAAATGCGGCACTTTGACGGTATCAAGATCATATACTGTACGCCGCG
ATCATTTTCGAACGAACAGATAAAGAGCGCGCTGGATGAATGCCTTGAATTTAAAAGAAGGTGGCCGGGTTACATAGCCG
GTTTCGATCTGGTTGGCGAGGAGGCCAAGGGCCATCCACTAAAGAGGTTTGCAGTTGAACTGCTTACGTTTCGACACCAG
TGTATTAAAGAGGGCTATGATATCCCCTTCCTCTTCCACTGTGGTGAGACGCTCGAGATGGGCACCGACGTCGATCGCAA
TCTGGTGGACGCCCTGGTGCTGGGCGCAAAGCGCATCGGCCACGGCTTCGCGTTGCCTCGTCATCCGGTCATCCTGCAGC
GGATGAAGGAGGAGGATGTCTGTGTCGAGGTCTGTCCGATTTCTAACGAGATATTGGGCCTGACGCCTCGCATCGGCGGC
CATGCCGTCTACAGCCTGCTGGCCAACAATATGCCTTGCACGGTAAACAGCGACAACGGCACGCTCTTCAAGTATGTGTC
TTGATGATTTGGCATATTCTGTCTGCCTCATACTGAATGCTCAGCCCTATGCTAACAGCCCCCCGGCAGGTCCACTCTTT
CCCACGACTTTTACCAGATCCTGGTGGGCAAGGAAGACATGGGTCTCTTTGGCTGGCGACAGCTGGCCGAGTGGAGCCTG
AAGCACGCCTGTCTGAACAAGTCCGAACTGGCCGAGGCCCGGGTTCACTGGCTCGCAGCTTGGTGTCGCTTCATTATCTG
GTTGCTCGAGACGTACGGTTTGGCAGACAAAGATACAAAAATGGTACTGGCAGAAATCGCAAATGGAGATAAGAAAGCAG
CGATAGCCTTGGACTCAAAACAGACTACTGCGGCAGAAAACCCGGCCACAACCAAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62