GenePrediction:GLEAN_42 Details

Name: GLEAN_42
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:316878..318671 (+ strand)
Length: 1794
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:316878..317300 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_179:317420..317829 (+ strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_179:317900..318671 (+ strand)
Length: 772
>GLEAN_42 class=GenePrediction position=GCSC_179:316878..318671 (+ strand)
ATGATTTCCCCGGCACCGGCGTCAGTTGGCCAAGAGACCAACAACGGGGCCACTCCAGGCACAACCCCCAGCCATCCGTC
GAACATGAACGTTGATGGCACTACGAATGCCTTGTCTGTCAACACTGGCTCCGGACAGCTCCCAGAGCGCTCACCTTCAC
GGTCTAGTGTTCGTGCCAATGCATCCCATCGCCAGAGCTTTGTGGAAAACCTGCGAAACCCACCTCCATCTCCCCGCTCT
CTCCGCCACCTTTCCTTCACACATCAAGCGGTCCAGGACCTGGTCAACCACCCACCACCACAGCGTATGGCCAATCCGCG
CTTTGCCGGCCGTGACTGGCAGGACGTCTCGCTGGGTGAGCTGATCTCCGACCACGAGGTGAAATGGGCCGAGCTTGACA
CTACTGTCGAGGATTGCACAAAGGTAAGAAAGGCTGTCGAAACATAGGCGGGAATAGAGAGCTGAAATATATGGGGTTTT
AGATTCTCCTGAGAAATAATCCGACCGGCACAGTCTTACTTCGCAACCATCCCTCCGATAAGACAGCCGTGGCCACGTTC
GACCACAGAGATCTCAATGCCTACCTGCTCGTCGTCATCGGCCGGGCCAAACCAGAGCCAACAGAGGTCGAGGTGTACAG
AAGCGTTGCCGAACGTGCATATGGCCGCGTCGGCATCCCCGTCCGCGACATACAGCCTATCTGCCACAAAGACCCCATCA
CAACTTTGCTTCTGACACAGAATCTTGCCGCAGCGATTGAGCTCTTTGGGAGCGGGGTGCGTCGTATTCTCGTCACTGAC
CCGACATCATCCGAAGCCGTCGGTATCCTCAGCCCGCTTCGCCTGTTGGAGTTCTTCTGGATTGAGAGCGTCAATTTTCC
CTCAATCGATCGACTGTACCCAATGATACTGCGTGACCTGCGCATCGGCTCACAGGATATAATTTCCATCAAGTAGGCCT
CCAATTCTTCCCATCATGCAGCTGCAGCTGCAGCAACTCCGTAATCTAACTAAATAATACAGTGCCGATCGTCCTCTTGC
GGATGCCCTCACGCTGATGAACGACGAAGGCCTGACATCGGTGGCGGTAGTCGACAACGGACAGAACGTCGTGGGCAACA
TCTCCACGACTGATATCGAGCATCTGACCTCTGTGGCTAGTTTTCCGCTCCTGCACTCGTCTTGCATGCATTTTATTTCA
GTCATCTTGTCAGAGCGCGGCGTCGAAGAGGGCCAAGACTCGTTCCCCGTCTTTTCCGTTAACCCGCACACGACCCTTGC
CCACACGGTAGCCAAGTTGGTGGCGACGCGGTCGCATCGCATGTGGATTGTCGACGTGCCCTCGCCATCAGCTTCAGCAC
CACAGACCCCGCTTCTGACACCCGTGACCACTGGCCCTGTTTCCGGCTCCAGCTTCATCTCCCCGCCGTCCCATCAAAGG
AGCAGTAGCAACGCTTCGGCGTCTGCAGCTGCGGCTAGTGCAGCTATTGGCTGCAGTGCCAGCCATAGCGATGGCATATT
GATCAGCATGACGAACAGCACGAGGACCTCCGGCTCGGCTCGCGAACCTTCGAATTTTGTGCCCGATCTAAGCGCTACGG
GCTCAAGCAACGGCGCACATGTGTATGGATCTGTGCCGGCTGCTGCAATGCCTGGTGCCCACCTCTCTGGTCGGCTGGCG
GGAGTCGTGTCGCTCACCGATATCCTCAATCTGTTCGCCAAGACGTCGGGTCTCCGACCGGGGGACCTCTCTGATATCCG
AGCACGGCGACGGCGCAGCAGTAGTACGTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62