GenePrediction:GLEAN_4300 Details

Name: GLEAN_4300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:782292..780757 (- strand)
Length: 1536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:782292..782134 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_179:782092..781796 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_179:781693..781226 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_179:781202..781115 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_179:781067..780757 (- strand)
Length: 311
>GLEAN_4300 class=GenePrediction position=GCSC_179:782292..780757 (- strand)
ATGAAGTCTGCTTCATGGGACGAAGAAGTTCTACCCCCCGAGTATGTTGCCGGACCTCAATCGCCATCCCCGGCTGTGGC
CAAGCAGCAGCCCAATCACAACACCAGCACTAAAGCTGGCTCGGAAGCTGACGCCGGAATCGATTTGCTCGTACTACCAG
TGAGGCCGGCATCTGCTGCTAATGTGCCCTCTATCTACAGGCCACACTCGTCCCCATCTCCCAACTCTCGACAGCCTCTG
TGCCTGCAGGAGGGGGCACAGTCGGCGATGAGGCAAAAACCCGGACGTTGATGCAGAAGATTGGTGCTACCAACATGCTC
TGGCTATGGAAAGTGGCTGTGCGCATGCTGATGATGATTGCTGAAGCCATCGTGGTTTCCTGCATGGGTGCCGCCATAGG
CAACGGAGCGTGGACGAGCCTGAAGCACAATTACGATGGCCTTGATGAAGGTTGGTCCAATATCGACAACGAACTGGTGG
GCTTTGCTGTGATTCCCGTATGTGTCCGCGTTTTTTAGTTTTGACTCACCCCCTTCCGGTTGCTCCCTTCCCCTTTCCCC
TTTCCTATACTTTCAATACACTTTACTAACAGCCCGAAGATCGCGGTCTCCTTTCTCTGGTGCTCCATTGTCGCCATCGT
TCTGATAAAGCGGCGTCCTGCCCACCCTCTCCATCCCGGCGTCCCGCTCGGCATTGACCTCATACTGTGCCTGGTGTTTA
TAGCCCCTGTGATAATATTGAGGTACTGCGTCACGAACGTGGAGGAAATTGGCGCCGACCGCTTCATCCGCGATCCTGAT
GGTGGCCATGAGAATTACTATGGCTACTACACCCTGGTGCCCAACCGAACCTGGGTCTTCACCATTGCGTCTGTGCGAGG
GACCTATACCACCACCACGTATAAAACGGTCGTGATACCGACCACGGCCGCGACTGTGCCTCGGTCGACTGCTGTATCTG
TGACGGTGGCAATGCGCGACGAGCTGGTCGGCACGCCACAACAGCAGCTCCCGCCCAGGGTGACTTCCTCGGTGAGCAGT
GGTGCCGACAGTGGCAACGAGGCTGACGTTGTGATACCGATATCTGAAAGTTTAACAACATCAAACTCACCGACATTGAC
AACGTCGACATTGAGGCCACCGAGGTTATCGGCTTTGAAAGCATCGACACAAACATTGGTTACAACTGTCACGCCGGGAC
CCGTAGCCCGCACATGCTTCATCAGCTGCTCCCGAGGATGCCGATGTTAACTTGTTTTGGACTGCTCGCCAGGCGCGCCT
CAGAGAGTTGCTGGTTTCGTTCGTGCTGCCGTGCGTCGTACTGCTGCTGCACTTTACCATATTCGTGTGGGCGTGCAGTG
ACAGGAAGCAGAACAAGTCGCGGCCGCGTAATGCAGCCATCGCTTCGAACGCGCCTAGGAACGTGCGAAGCCGCAGACAT
GTCATGGCCAATGCGAACCGGCACGGCCAGTTGACAGGCGGAAACCCGGGCGTGTCCAAAACCAGGGAAGTCGTCTCGGC
TTCCGGTCTCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62