GenePrediction:GLEAN_4302 Details

Name: GLEAN_4302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:760859..759031 (- strand)
Length: 1829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:760859..760215 (- strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_179:760144..759931 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_179:759866..759456 (- strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_179:759190..759132 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_179:759072..759031 (- strand)
Length: 42
>GLEAN_4302 class=GenePrediction position=GCSC_179:760859..759031 (- strand)
ATGTCGATCCTTGAAAACGCCCGGCAGGGCACTCTTACCGGCGACTTTATCGACAAGCGGATCGATAAAATACTCAACGG
CCAGGACCCGGAAACGGGCCTTACCCCCTTAGCGACAGCAGTTGTTGAAGGTTTTCCTAACGTGGTCAAAGCGCTTCTGG
AAAAAGGAGCCAAGGCCGACGGCCTCTCGCAGAATGAGGCAACGCCTCTGCTTCTCGCCGTTTGGAAGGGAAAGAAGAAA
GAAAACTGCGCGCAGATCGTGCAGCTTCTATTGCAGAAATTGCCTCCCGGGCCGGAATCAATAGACAAGACGTGCAGTGC
AGCAGACGGAAAGACTCCATTGATCTTTGCGGTCGACCGAAAGGAGGCCGAGAGCGTGCGGTTGCTGCGTAAGGCCGGAG
CAGCACTGCAGACAGCGAATGGCCTGGACGCGCAGATGATTGCCAAAAGGAATGCAGAGAAGACCGGCGACTGGTCTATC
CACCTCGCACTAGATCCAAAAGAGGACAAAGAAGCCCATGACAAAATGACCGAGACTGTCATCAACTATCTTGTGTACAT
TCTTGCCTGGGCGAACAATTCCCTAGATGGAATCGTGCGTAAAACCTACGGATTGGACCCAGTGCTGAACGGAGATTATG
ACGGGGTGAGTTACCGGGAGAGGTATTTCGGCTTACAAGATGTGACGCACACGTTTATCTAATAATGGGATACAGAACGT
CAACTACGATGGACTTACGGATGACAAGGACCGTTTTTTAATAAATTTTGACGACTTTCTCAAGAACACCAAATTAGCTC
AGCCTCTAAGACAGTTCTTCGGGAAACATGTTTCATTTGTCGAAGAACTAGCCAGCTCGGTCGTAAATCTGCAGGTGACT
GGAACAAAAGCGATAAACCAGGCACTATACCAGCATGTCATTTACTGCGGTACGTAAAATGGACACAAATCATGACCCTT
TCAATCGTCCCCCTTCTAACCCCATCCATCTAGACGACAGCAGCTCCATGAAGCGGCAGAGCCGTTGGGAGAATCAGAAG
CAGCTTGTCGAGCGCCTCACCAAGATCATCACCCGCGTGCTTCCCGTCGGTGAAGGCGTCACGCTGCGCTTCATCAACCG
GGAGTTGGCTGCCGCTGACTCCAGCCTAACGGCCGAATCCGTCAACCAGATTCTGGGCCCTATGACCTGGCAGCCCGGTG
GCGACACGCCCATTGGAACCAATCTGCGCTCCAAGATCTTGGAGCCGCTTGTGTATGCCAAAATTGCAGACAAGACCTTT
TCGCGGCCGCTACTCGTCGTCGTCATCACGGACGGCATGCCGGAGCCCGAGAGCAATTCGGCACTAACTGGTGCGATTCT
AGAGTGCGGGCGGAAGCTGAAGGAGGCACAATACCCAGAAACTAGTATGTCTGCACGTACACACACACCGTCTCTCCTTT
TTTGTACTTCTCGCATACTGACGAGCAAAGGCGTCAAGTTCGTGATCGGACAAATTGGCACCGCAAACAGGGCTACAAAG
TTTCTAGATTCTCTAAGAGGAAACCTGGACCTTCAGCGAACGACATACATCACCTCTGGTAATTCCTCCTATCCCCGACT
TTATCACTGGTGCCGCTTTGACACACTGCCATCTATTTCTATACTGTCTTGCTGACCTACGTGATGTAGAAAAACTGGAT
GCGGAGTTCATCGACCTCAAGGTAGACGAGAAGGGGCTGGATCGATGGGTAAGATATACATCTAGATTCGCTTCTCTCTC
AGTGTTCTTGCTAACTATATCTGGTAGCTTATCGAAAATTTGTTCTCTCCGTTCCAAGGCAAACTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62