GenePrediction:GLEAN_4304 Details

Name: GLEAN_4304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:752913..750974 (- strand)
Length: 1940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:752913..751621 (- strand)
Length: 1293
Type: CDS
Source: GLEAN
Position: GCSC_179:751525..750974 (- strand)
Length: 552
>GLEAN_4304 class=GenePrediction position=GCSC_179:752913..750974 (- strand)
ATGGGAAGAGACAAGAAGACGGTGCAACTTCGCGAGGACGTTTACGAACTCCAAAAAGCCTACGACGACAAGGACCCTGA
TAGCAAAGAGACACAGCGAAAGAAATTGGTCATGCAGAAAGTCTTGTGGTCGTTCCACATAATCCAGCAGCTCGACCCAA
AGGACCCCAACTCCTTCTTCCAGATTGCTGGCTATCATGGCATGCCATTCCGGGGCGCGGGCTGGGGCAATCCGTCTTGG
TGGGGCGGCTACTGTAACCATGGCAATGTGCTGTTCCCTACCTGGCACCGCGCGTACTTGCTGCGTCTCGAGAATGCCCT
ACGCAGTGTCAAGGGCTGCGAAGATGTCGCCCTCCCCTACTGGAACGAGACTAGCTCGGGCACACGACACAACGGCATTC
CCGACATCTTTCTTCGACAGAAGGTTACGATACCTAGTTCTATTCATGAGAAATCCGATTCGGACCTGGAAATCGACAAC
CCCTTGCGGTCTTACACGTTTCAAGATGGCATAACGGACAACCTACAGCCAGTGCCCGACGCAGATTACTCTAAGCCTAA
AGGCTACGAGACGAAGCGATACCCGTTCTCTGGACTCGCTAGCAGTTCCGATATTGCTGCAACCAACCAGCACAATATGC
TGATGACTATTCTCAACGGCAATGATAACAACACAGACAAACTTCTCAACAAAAACGTGAGAGACTGGCTAAACAACTCG
ATAACCCTGAGCAGCGGCCAGAAGTATTCGACGAACACGGCTTGCAAGTATGAGCAGTGCTTGAAGGCTCCCTCCTACAC
AGTATTCTCCAACGCCACTTCGGCCGCCCAATACAACGATGACATCTGCAATAATACGGGGGGGAATTACGCGGACTCCA
AGACCGGCTCTTCCAATGGTCCCACCAGCTCTGCCGTCGTCTCCCTTGAAAGTGCCCACAATGACATGCATCTGGCCGTC
GGAGGTTTCAGTATTCCTGGAATGGGAGACTTCGATCCTATCATTGGAGCCAATGGAGATATGGGTGAGAACGACACGGC
CGCGTTCGACCCTATTTTCTACTTCCACCACTGCTTCATCGACAAAGTCTTTTGGGACTGGCAGAAGACATGGGACTCTA
CCTTGAACTCGCGGACTCAGCTGACAATTGTGCCTGAATATCCTGGCACCAACTCGGTCGACTCCCAGGGCCCAACTCCA
GGGGTTGCTGGAAACACCTGGCTGACTATGAAGTCCCCCCTCGCCCCGTTCACCAAAAATGACGAGCAGGATGGCGACCC
GCTTACCTCAAATGTAAGTTGAAACAAAATCCTAGCAGTGCAACCAGGAAAGTGTTCCTTGTCGGGCGTTGTCTGTACGT
AAGCTAACCATTGGTAACTCTGCAACAGGATGTCGTCAACATTGTGTCGCAGCTGGGCTACAAGTATTATGACTGTGATG
ACAAGACATATGAAAACGGCACCTCCTGCAAAGACGAAACATGTGGCTGTCGTCATGGTGCACAAAGAGCGTCCTTGGCG
AACAAGGAGTCGCGCAGCTTGTTCGAGCTCCCAGTTGGCAACAGTGGGACCCCCGAAGAGAAGTCAATGGATGTCGTGCG
CATCTCAGGCGTCAACCGGGCAACAATCAAGGGTTCCTTTGTCCTAGTCGCCCGCGCCACGATAGACGGGCAGGAATGTG
TAGTAGGGACGGAGAGTGTTCTGAGTCGCTGGGGGCAGTCGGGTTGTGCCAATTGCCAGAGCCATCTTGGCGTCAAGGCT
TTTGTGCCACTTTTTGGACTTGACCACAAGGTCCTTCACACCGTTAGGGTTGGCTTGCACGGCCACGAAACGAGTGTCGA
CAACCTCAACTCTAGTAGTGGTATAAAGGGGGGCTGGCGCCTAGGCAAGATGGGTACGCCGCATGGAATCCAACCTACGC
CCGCCGCTCCAGCTCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62