GenePrediction:GLEAN_4306 Details

Name: GLEAN_4306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:745983..744676 (- strand)
Length: 1308
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:745983..745755 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_179:745676..745563 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_179:745445..745155 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_179:744990..744869 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_179:744825..744676 (- strand)
Length: 150
>GLEAN_4306 class=GenePrediction position=GCSC_179:745983..744676 (- strand)
ATGGAGCGGCCTTTGACGGCAATTGACCAAAGCCATCGTGATGGGTATCACCACAGCAGACCGGCCCCGGTCAACCCTGC
GAAGCTCGCAGTCCTGCGGAAGAAGTACGATGAGGAGGCTCAGAAGCGGCTGATTCAGCAGGGCACGAAGTTTCAGCTGT
CGGAGGCGAGGGAGCAGCGTCTACGGGATCTGAGTCAACCATGCGGCGTCGATGCCGGCGGCGACTTTGGTGGCACATGA
TACTGAAACCGGTTTTCGGGGCTGCACTGCGACATTGAGAGCTACTTGTACCTTCCGGTTCTGGAAGAGACAGGCCACGT
GCTGAGAGTCAAGTACGCACCGGGTGACGAGATCCGGCAGCAGTTGGTGCGGGTGGTCGTGCAGTGGCATCTGACCGACA
AGATGCCTCTTCTGAACAGACGTTAGCAGGCTCGACTGGGATTACCAGACGTCACATTAGTGTGTGCGAGCGGTTGAGTA
CCGGCCGGGACAATCGCCAACACGCACGTCTTCCAGACTGAGCACGTGTACCTGGCAGAAGGTATCTTGACGCAGCCGCA
AGTGCCCGACGTTCTGGGGCTGTTCTCGTTTGCAGGCTCGCTCTGGCACACGGCCCAGTGGAACTACGGGCTCTCAGGCT
TCTCGCCAACAGATGCACGCCTGACTAGGCTGCAGGACAAGCTCGTGGCCGTCGTTCCCGAGGTGGCCGTCGTGAGTGAC
CGAGCTGTACGTCGTGCAGCAGACGCCGCCGCAGATGTTGCCACACGATCAGAAGCCGACCAACCCGGTGTTTCGAACAA
CGGCCGTGACGGGGCCCGGCTGACAGCATGTCCGCGCCCCCAGCCTCAATAAGGGTAGAGTAACTCAGAAACGCCTGGTG
AGCCCATCCTGTTCGGTGACGGCTGGACGCACTCGTCGGCCTAATCGGCCATATTCGGCACCGTCGGCCACACAGTACTG
CAAAACAGCTCGGCGGCTAAGCTGGCCGAGCAGCTGCTCGCACACGTCGACAGCATCGTAGCCGACCCGACGACAACCGT
CAGGCTCAAGCCTTCAACCGGCCCAGCGTCCAGCTTGTCGACCCGGACGGCCGCGGGCTGCAGGCAGTGACGCCGGTCAG
CCGAAGAGCCCAGGCGCCCTCGTTAAAGCCAAGTCCAGGGCCAGGCCGCCTACATCCGCGAGATCCTCCTGCGCGCCCAG
GGCGCCACCTGGTCCCATGGGACCGTGTCGCGAAACGCCTACACGCATCGTTGGAAGAACGCCGGCACCCCAAGTATTGA
CCCGGATAGAAGTGCGGCTGAAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62