GenePrediction:GLEAN_4308 Details

Name: GLEAN_4308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:727037..726365 (- strand)
Length: 673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:727037..727035 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_179:726967..726832 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_179:726741..726365 (- strand)
Length: 377
>GLEAN_4308 class=GenePrediction position=GCSC_179:727037..726365 (- strand)
ATGGTGAGAGAGAGACCCAGATCTTGTATGGCATGAGATTGTCGAATGACTACTTACACGGCGTGCGCAGGCTGAGAAGA
CCAACCCCATGCGGGAGCTCCGCATCCAGAAGCTCGTCCTGAACATCTCTGTCGGCGAGTCTGGTGACAGACTGACTCGT
GCCGCCAAGGTGCTCGAGCAGCTGAGCGGTCAGACGCCTGTGTACAGTACGTTGCAATGCTGTCCAAGGCCATTGCAGCT
CAAGCACTTTTCTCGGCTCCGTTTTCTCTAACATGCTCTTTTTCTCCCTCTTTCAGGCAAGGCCCGCTACACTGTCCGCA
CGTTCGGTATCCGCCGTAACGAGAAGATCTCTGTGCACGTCACCATCCGCGGCCCCAAGGCCGAGGAGATTCTGGAGCGT
GGCCTCAAGGTCAAGGAGTACGAGCTCCGCAAGCGCAACTTCAGCGAGACGGGCAACTTCGGCTTCGGTATCAGCGAGCA
CATCGACCTGGGCATCAAGTACGACCCCGGTATCGGTATCTACGGCATGGACTTCTACTGCTGCATGACCCGCCCGGGTG
AGCGTGTCTCCCGCCGCCGCCGCGCCAAGGCCCGTGTCGGTGCCAGCCACCGCATCAACCGCGACGAGACCGTCCGGTGG
TTCAAGCAGCGCTTCGACGGCATTGTCCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62