GenePrediction:GLEAN_4312 Details

Name: GLEAN_4312
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:700441..699703 (- strand)
Length: 739
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:700441..700112 (- strand)
Length: 330
Type: CDS
Source: GLEAN
Position: GCSC_179:699765..699703 (- strand)
Length: 63
>GLEAN_4312 class=GenePrediction position=GCSC_179:700441..699703 (- strand)
ATGATGGCGCGACCGACGCTGGGATACGGCCCGGACGCGGAGCATGAGATAATCAACATATTGTGCATAGAAAGGAGGCC
CACGCCCCTGGTAGAGGGCGTGCACATGACGCTTAATGCGATCAGCCGCACGGCCGTGAGAAATTCCCAAGCGGCGGCAG
TTCAGCATGGCGGGGCGAGCGATGGGGAGCCAGGACTAAGGCACTACGGGCAAGGCTACTTTGCTACCTTTGTAGTCTGC
TCGGACAGCTGGAAGCTCGAGGCCGTCTGCCAAGGCGTGGAGGCGAGCGACGAAGCTGAACGGACGGAGGAACCCGCAAG
GGATGGAAATGTAAGATGGCACAGAGCACAGCGTGCACATATAGCACCGCGCCGTATTTAGCCCGTAGAGCTTATCGTCG
CAGGCTGAGGCAGTTTTTGTTTTTACATGGAGAAAAGAGAATCGAGACTTGGTCTATCCGGGGAAGGTTTATGCGAACTC
TGTTCGTACGAGGTTAAAGTTTGGCTCGTTTTGAAACCAGTGTTTAAGCTAAGTTGTAACAATAGTGAAACCGAGAGTCT
GGGCCCGTCTTCTGTCCAAGGGAGAATAGACGCCTTGTACAGAGTACAACGAGGGTGTATTACCCCAGAGATGACAGGTG
TGTTTGTATACATAACGCGGACTCGTAGACACACAGCATCTGTGCTGGGCACTCGTCCCGGCAGTTACATATCAGGTGTG
GGGCAAGCTGATAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62