GenePrediction:GLEAN_431 Details

Name: GLEAN_431
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1722903..1726914 (+ strand)
Length: 4012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1722903..1722923 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_167:1723027..1726914 (+ strand)
Length: 3888
>GLEAN_431 class=GenePrediction position=GCSC_167:1722903..1726914 (+ strand)
ATGATGCAAGCAGTGCCAAGCGTAAGTCGCCGTCGCGCCGGGCTTCCATCATGTTGCCCCGTCTCCTTGAGTTTGTTGAC
ATCCGCCGATTAGCGTCGCTGACTCTTAACCTCTCCCGATGCAGCTTGTTGGGACGGGCACAGCCGTTGCTGCAGCCGCC
TCCGGCTTGGTATTCGCACAGTCTACCGACGAGCAACCGCGCCGACGGCCTGCCTCCGCTCTTCCAAACTGGTCCTCCGC
CTTCGACAATCCCTCTTCTCCATCTTGTCCGATCCCCACATCACGACCGCATGCGAAATCTGTCAGCTATGCCATGAGTA
CTGAGTACACAGGCTACAGCTACAGCTACAACAGCCAAGATAGTTCGTCTGCTGGACAGCACCCGACGCCTGCCCCCTCA
ACTGGCGCCACTCTTCCACAATTGGCTGTCGCCACCCCGATCCCTACCCCAAAAGGCGTGGGCCGTCGCCGTTCTCTTAT
CCACAGAGGCGATGCGCACGCCGTATCTGACGCCTCGCGCGACTCCGTATCGTCTAATGGTTCCTGGATACGGCGTCTTT
CCCTCCGGCCACTCTCCCATGTTGAGAGTTCGCGATCAAGCATTGGCCCCGACTCACACTCCATGAACTTCTCTCTCGGC
TCTTCTGCTCCCATTGTCTCCCCTGGACCTGCCACCTCTGCTCAGCAGCAGCCTAGAAATAAGCTGGTGAAGCGAACGAA
AGCTGTCCGGGATGGAAGCTCAGACTCGCTTAAAAGGCGTGGCTCCCGTTCCCAGTTGCTCACCCTACGACGGCCAGCAA
CGAGCAATCAGCGCTCTGCTACCCTGCAGCACTCGCCGCTAGCGGCAGACAGCTCCTCCTTCGTCCCATCCACTCCTTCC
TATCCCAAATGCTCCTTCGAACGGTTATCCTGCACCCCGGAACTGGACGACGAAGTGACGCGGGGAAGGAAGGACACTAT
GCCCACAAGGTTGCTGTCGTTCTTCCACGAACGGGTAGCTAAATCATCCGCGTCAAGTCGCGGGAACTCTCCCTTTCCCA
GGGAGCGGAGCTCTAGCGTCTCTAGCTTCCAGCGCAATCCACTTCCGACTCGAACGATCCAAGTCCAAGGCGGCCAGTCC
TCGCCAGCAATTCTCACCAAGCCGAGCACACTTCGCCCCCTGCGTCTAGGATCAAAGCACAGCAGAACACTGTCTTCTCT
GAGCTATGCCAGGGGCACGGGAGAAGAGCACGAGGAATCCTATTCTCAGTTCACACGTGCAAGGCGTTCTTTGTCCATAC
ATCTAAGCTCGCCCATTGGCTGGATATCAAGGGCCAGTAGCTTACGTCGGTCAAAACGGGGATCGGAGTATTCTGCGAGC
AGCAATGCCTCCAGCAGCATCCCCAATCTGTCCAGCCCACCCACCAGTGGCAACAAGCGGCATGTCTCTGCTCCATCACC
AACGACGCAGCTGCCGTCTCCACTGCACACACATATGCAACCGCGTAGTGTCACTGCACCTACAGATTTACGCCTACATA
GGGTCATGGACGAGTCAGGCTTCGCACAGTCTAATCGGGCGTCGCATCGGGATCAAGACATGGTGGTACGACGGAGCAGC
CCCATCCCGCCCTACTCATCGGACAGCTCCCGCTTGGTACCCGGGCGACAGCGAAACTCGTCTTCGCCTCTGCCTATAAT
ATTGGACTTGTCAAACTTCAATGACCTCTCTCGGTTAGGTCTAGCTATAAGTACATCAGAAGCGGTCGTACTCTCGGCAA
AGGAGGGGGGGAGACAGCGCTCGCAGAGTGCTGCAGCGTTTGCAGGTTGCGCATACCCAGCAATACCGAGAGCGTTTCCA
CTGGTCCCACACAGCAGAGAGGTTTCGTACGAACGCTCTTTTACTGTTGCCGGCTCGGAAAGTGAAATGCGCGGCTTCGG
ATCATCTGGAGACGACGACGACACGGACTTTAAAAGTGAAACGCTATTTGACTCTGTACGAACGGCAGCCTCGGCTCGAA
TTCGAATAACAGACACTCCGATCGAATCGATGTTTGACGAATCGCCACCGGGCACAGCAAGCAATACCAAGTCTAAGCGA
TTATCTATACAGGAGATTTTAGGCCAGTCTTGGGACAGCGATACCAGGATTCTTGAGGAAGACGAGGGAGCTTCTACGCC
CATGAACGCAGCGGTTCGCAAATCACTGACACCTACGCTGCCTGGTGATCAAGTGCACAGTTTCGGAGCCTTGAACTCTG
GGGCAAATGCCATTCTTGCGTCATCTGCAACAGCTTATCGGGTAGATCCCAGCCTCGCATTTGCGCATGAAATGAGCTTT
GCTAGACTATCGCTGGACGACGATGATGCTGACGATGACGACAATGAAGGCTGGGCCCGCATTGATGACAGCGGCGTGAC
AAACAACCTGTCGCCGCCTTCATCACAATCGAACTCGCTTCGTGGCTTACATGGACTGCACGCAGCTGGCATCGATATCA
GCGGTAGCCACCGCGCATACCCCGGCCAACGGCCGGCACTGGCATTCATGAGTGGGAATGGTACTTCTGAAGCGGGCACT
CACTGCGGTAGCTCAGTGCACGAGATCGAGCGGGTGCGAAGCAACCTGTTTGACTGGAGCGAGTCTACAGCACAGACGGA
TAAAGCTCACGCGGATGGTCACTCACCCCGGCCGAAGACGGTGCATGGCAAGCAAGAGATGGATCTGCGGGGTGGACGCC
CGTCAAATCGAAAAGGGCCAGGAGCTGGTCATGTGCGGAGTCAGAGCGTGCCAGCTCTGGCAGATTTTATAGACGGAGCA
AAGCCGACCACATCCAAATTTGGGACCTGGGCTTCATCGGGACCTAAGAACCCCAGCGAGGACTGGGATGACGATTTCGA
CTTTGAGGCAAACGGTGATGATGACGCCTTTGTTGCTTTTGGCAGCAGCCAACTGGGTGAAGCAGCAGGTTCGATCAAGG
GCCCTTCTACTCCCTTTGCCATGATAGTACCGGCCTCGATTCAGGCGACACAACCAACCGTCAAGGCCCATTCGGGCCAG
ATACGAGAGCTGTCCCTTTTGGTGGACGGACTAAAGCGTCTGTGTCGCCACGCCCGAGACCTGGAAATCGTCAACGAATC
ACCTGCGCTATGGAAAGAAGCCGAGAACATCATTGCATTGGCGTCGCCCGATGAAGAGGTAGAAGGGACAGCGCCGACCA
GCTCTGTAGAAACTGATGATACCGGTACCCACAGCGATGGTGACTGGAGCCGCCGAACGTCAGCCGAATTTGGGCTCTCG
AGCACCGATGCCCGCTTTGTGGACGACGGCTTTGATGCGGGCACCTTGAACAGTTTCGACGACGTTTTAAGCTCGCCTCG
TTTATCGCATCAGTCGGCAACATCGCCACCGCACGAGATGAGCAGGACCGCTGTCGTTCGCGAGCGTCAGGGCTTGCGCA
GGCGATCGGTCTTTTCACCCGAAGACGACATCTTTGGTGGGGGCTGGCCATTGCGCGATGAGACGGCAGTGGGAGTGACT
GAGCAGCAGAACGTGGAGGAACAGGAACAGGAACGACCTCGGACTCCCGAACGACCTATGGCTGCCAGCGAGACTCCCGA
TAGTGCGATGATCGAGTCTATCATGGAAGCCATGCAGCAGCAGCGGTCGACATCAGCTCCGATCAGAAAGTCGCCGGTCA
AGACCAAGTCTACGGAGCTGTTCTTCAACACTAACACGCTGCAAGAACTTGTGAAACGGGCCAACACGCTCTACCATTCG
CTGTCAGACCTTGTGCGCCGAGCAGAGCTCCTGACGCAGAGCCCTTCTTGCACCCCGAAGCACGACCGGCCTTACCGACG
GGATGATGGTAGTCCCGCCTTCACACGCGTCTTTACTGACCCGTCGACTCCTTCCAGGCGGCTGCCTAATAGCCAGAGCG
CCGGCTCATTGCTTTCACGAGCATCGCCTTCAGTTGAGTCGCCCGCATCAACAGGCATCAGCCGGCGCCTACAGCTGATG
ACGGTGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62