GenePrediction:GLEAN_4321 Details

Name: GLEAN_4321
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:657044..656579 (- strand)
Length: 466
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:657044..656862 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_179:656764..656579 (- strand)
Length: 186
>GLEAN_4321 class=GenePrediction position=GCSC_179:657044..656579 (- strand)
ATGCCTCCGCCGTCTGAGCTCGTCATTGCTACCAAGGCCGTTGAGCGCCTCGTCAAGGAGGAGGCTTACTACCACGCCGA
GCTGGCCAAGCAGGAGGAGCGTGTCCGCAAGCTCACCGCCGACATCGCCACGTCTCGGCCCGAGGATCTCGATCCCAATG
CCGATTATGTCCTGAGGCAAGAGGTACGTTGTTCTATTTCTTCTTTCCTCGCTCCGCTCGTTCTTTTCTTTCCTCGTTCA
CTTGATTGGCTCTTCCTTCTCCCACCCCTAACTCTGTCAGACCCGTGCGGCCGAGGAAACAAAGGCCGTCTTCGCCCCCC
TTAAGCTCCGCACCCAGGATGCCGTGGCCAAGCTGGAGGAGCAGATTGCTTTCCGCGAGAGCTCCGGCGCCGCGGCCGAC
ACCGAGCTCGAAAAGGCTCGTGCCATTCTTCGCACCGGACAGACGGCCATCGCCAAAGAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62