GenePrediction:GLEAN_4323 Details

Name: GLEAN_4323
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:651819..646490 (- strand)
Length: 5330
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:651819..649844 (- strand)
Length: 1976
Type: CDS
Source: GLEAN
Position: GCSC_179:649787..648185 (- strand)
Length: 1603
Type: CDS
Source: GLEAN
Position: GCSC_179:647991..647700 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_179:647643..647518 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_179:647286..646490 (- strand)
Length: 797
>GLEAN_4323 class=GenePrediction position=GCSC_179:651819..646490 (- strand)
ATGGCAGACGTCAGTCCTAGCGGACCAAGACCACAGCCAGGCCCAGGCCAGACCGGGCAGCCGAGCAGACGTGGGCGGGG
ACGGGGCAGAGGCAGCAATCAGCGGGGCCGGTGGCATGGACCAGCCGGGCTCGAGAGGGGTAGTCGTCGGGGAGGTTTTG
GCCGTGGCCGTGGAGCCATAGCTTCCAGGCAGACATCGATGATTGCGCCACCACGAAGCTTTGGAGGACATTTGACGGGA
GCAGGAACTTTAAACGGGAATGCAATCGAATTTGTTCCTGGACAGCAGGTGGACGTGGCAGATGTCTCGGGCTCGGTAGT
GACGGCAGCCAGACGCTCACAGCCGTCAACGGCAGAAGACTTGACGACACGAACACACGAGGACATTGACAACGGGCACT
ACGACTGCTGCATCTGCCTGAACGCGGTGGTGCGGTCGTCGCGGCTGTGGACGTGTCCGATCTGCTGGCGGGTGACGCAC
CAGGCGTGCGTGGCAAAGTGGCTCAAGCAGAAGCGAGGCGACGCAGACGACAACGACAGGGCGTTTGTACTGCGCTGTCC
GGCCTGCAACTCGGAGTTGTCGGAGGCGGCGGCACGGGAGCGTCACTGCTGGTGTGGGCGACAAAAGACACATGTTATCT
CGGCAGCAGTGCTGGCGCCTCACTCGTGTGGCCGGGTCTGTGGGAAAGCAAAGGGAAAATGCCCTCATCCATGCTCGGCG
GTCTGCCATGCCGGGCCATGTCCACCTTGTGCAGAGATGGGGCCTGCGCTGCCGTGCTTCTGCGGAAAGCATTCGGCGAC
GCGGCCATGTGTCGAGACGGACTACGGGCAGTCCTGGAGCTGCACGGAGACGTGTGGCAGCCGGCTGCCATGTGGCATTC
ACCGATGCGAGCGGGTGTGCCACGCGGACATGTGTGGCGACTGCACGGTCCCGATACCGTCTGTCTGCTACTGTGGAAGG
GAGGAACGAGAGATACGGTGCCAGGAGCGGGACGCTGTTCTGGACTCGTTTGACTACGGACAGCGGAAGGGAGCCGAGGG
AAGAGAGAAGAAGATGTTTGCAGGTTCTTACCGCTGTGCCTCGGTCTGTGGACGGCCGTTTGACTGTGGCGTGCACACAT
GCCAGCGGAGCTGCCACGCACAGGACGAAGCTGCTCGACACTGCGGCCTTTCGCCGGACGTGGTGACGCGCTGTCCGTGC
GGACAGACGCGGCTGGCCGATCTGGCGGTGGCACCGCGGACGTCGTGCCAGGACGCCATTCCAGGATGCGGCAAGACGTG
TGGCAAGACACTGAGGTGTCAGCACCGCTGTACGACGCCGTGCCACGAGGGCGCGTGTCCGCCGTGTGGCGAGACGGTGA
CGATGCGATGTCGATGTGGCCGAGCCGAGACACAAGCAGCCTGCAGCGACGCGACCGGACCTGAGTTCGATTTTGCGTGC
GACACGCCGTGCCGAGCGCTGCTCAGTTGTGGCCAGCACAAGTGCCGCAACATCTGCTGCAGTGGGCGAGAGAAGGCGGC
AGCCCGTCAGGCGGCATCGCGAGGACGCGCAGCAGCAGCAGCAGGGCATCAGGGCCAGCTCGAGTACGAGGCCGAGCACA
TCTGCCTCGTGCTCTGTGGACGGGCGCTGCGTTGTGGTCAGCACGGCTGTCCGCGGCTCTGCCATCGCGGCGCCTGTCTG
TCGTGTACGGAGACGATTGCGGAACGGCTCAGCTGCGCGTGCGGGCGGACAGTGTTGGATCCGCCGCTGCCGTGCGGCAC
AACGCTGCCGGCTTGCCAGCACGACTGCATGCGAGCGCTGCCGTGTGGCCACGCAGCCATGGCCCACCGCTGTCACGAGG
CGGACCAGCCGTGTCCGCGGTGTCCGCAGCTGGTGGCCAAGGTGTGTCTCTGCGGGAAGTATACGCTGAAGCGGGTGGCC
TGCGGGACGGACGAGCTGAAGTGCGACCGGGTGTGCGGGCTGCCGCTCAGTTGCGGGTAAGTGATGCTGGGCGGACGAGT
TTGTTTCCTACTAACATGACCAGACTGCACAGCTGCACCAAGACGTGTCACCGGCCGGGCGAGTGCGAGGATGTAGAGGC
TAGCTGCAAGCAGCCGTGCGGACGGGAAAAGACGCTCTGCGGACACGTCTGCGGGCAGCCTTGCCACGGGACGACAGCCT
GCAGCGAAGACGAGCCGTGTCGATCGCGGGCGGTGGCGACATGTGCGTGCCAACGGCGGCGGCAGGAGGTGCGCTGTCTG
GTGTGCGCGGCAAACCCGACGCCGACACGAGCACTGGCACCCAGCTGCGATGACGAGTGCCGACGGCTGCAGCGCAACGC
GGTCCTGAAGAGCGCACTGCAGATCGCAGACGAACACGAGGACGGTCACGTGCCATACACAGCCGAGACGATGGCCCTGT
TCAGCAAACAACGGGCCTGGGCCCTCGAGCAGGAGCAGCGGGTGCGTGCATTTGCCGACAGTCCAGACGAGCGGCGGCTG
CGGTTCCGGCCCATGGCTGCTGGACGACGTGCGTTCCTGCACCTGCTCGCGGCCGACTACGGGCTCGACAGCCAGAGCCA
AGACCCGGAGCCACACCGGCACGTGGCGCTGTTCAAGACGCCGCGTTTCGTGTCGGCGCCGGCCAAGACGCTGGCCCAGT
GCGAGCGGAGGGAGAGGGAGAAGGAGCGGGAGAGGGAGAGGGAGAGGGGGTTGGCAGCAGCGGCAGCTTCGACTGCGACA
ATGGCGACCGAAGCAGCCTTTTCTGTCTTGCCCCGTCCTTGCAATGCATTCTTGCTGCCGGCACTGCTGGCCGATCAGGC
GACGGTGCACGCCGACGTGCTGGTGGACGTGCTGCCGCTGGTCAGCGAGGGGCTGCCGGTTAGAGCACCCACAACCCGGT
TCGAGCCGGCCGTGCTGTCCAGTGGTGAGGCGGTCATCAGGGCGGTGGTGCCGGCGGTGGCGCCGGCGGCCGTCGAGCAG
CTGCTGCGATCGCTTCTGCCGTACGTGCAGGGACTCGCGAGCGGGTCGGCTGGCGGCCAGGAGATCGGTCTCTGCCACGT
GGATGGCAACCTGCAGGTCCTGTGGCACGACCACGACCCAGCGACGGCGGCTGCTGCCAGGCAACAAGGCGTCGACGTCG
GCCAGTGGAACGTGGTGGCCAGTCGTGGCGGAAGACGAGCGGCAGCACCAGGGAGCGGCAGCGGGACAGCGGCCGGGACA
GGAATTGGGACAGGGACAGGACGGCGGACGCTGATGCTGAAAAGACCAACAGCGGCAGAGAGGCAGAAAAGGATGGCAAT
TTTAGCGAGAGGGGAGGGGGTGGATGGAGAGGAGGAGAAGGAGGAGGAGGAGGGGAAGGAGAAGGAGAAGGAGGAGGAGG
AGGAGAAGGAGAAGGAGGAGAAGGAGGAGAAGGAGAAGGAGGAGGAGGAGGGGAAGGAGAAGGAGAAGGAGGAGGAGAAA
GAGAAGGAGGAGGAGAAGGGGGAGAAGGAGAAGGAGAGATCTGATGAAGAGAATCAGAAAGACAACCAAGACGAAGAGAT
CAAGCTGGACGCACAACAAAAGGACCAACTGAAGCTCGAACTTCCAGCCAACGAGGACCAAGGCGACAACCTCGATAAAC
AGGTCGAAGCGGTCGAGTCTGGCGTCGAGCAAACGGTGGAATAGGCTACACACAACAATCAATGCAGACTACAAGAAATA
CCAATGATTTCCACACGCCTACCTGAGTTTAGACAGTGATATCACACGCCTACAAGCATACAGAGTACATGCGTCGGACG
GAACATCCTTGATCCGGCCTCTTACATCTGCGCTCTCCCAACGCTAGTGCATGTAAAACCATTTGCAGCTGCTGTGGAGA
GGCAGCTCTGACGACCTCTGCCTACCGCTTCTCTCGACCACCGCAGAACACGGCTTCCTGCTCGGCTCCTCTGTCGGCCC
GCCTCTCGCCTCGTCTGTGCACGACTGTCCGATCTGCGACCGACTGCCCGCCCTCTGCGCCGTCCCGCCGACAGCACCGG
TCGATCGGAGCGAGACGCGTCCGCGATTCCAAGTGCGACTTTCGTCTGCGACTTTCGCCTGCCACACCATGTCGTCAAGA
CCACCGTCCAAGATTGTCTTTGTGGGCAACATCCCCTACGGTAGGTGGAGAGCATTGGGCCCGACAGCACAGCTGCAGCT
GACTGGCCGTCAACAGGCCTCTCGGAGGAGCAGATCAGCGACATCTTCAGCAGTGCCGGTCGCGTCGTCAGCTTCCGGCT
GGTCTACGACCGTGAGAACGGCAAGCCCAAGGGTTTTGGCTTTGCCGAATATCCAGACTCTGGTAGGTTTTTTTGTTTTG
TTTCTCCTCGCTTCGCTCGATCTCTTCTTTTTCTTTCCTCGCTTCGCTCGTTTTCTTCTCTTTCTCTCCTCGCTTCGCTC
GATCTCTTCTCTTTCTCTCCTCGCTTCGCTCGATTTCTTCTCTCTCTTTATCGCTTCGCTCGATCTCTTTTTTCCTCGCT
TCGCTCGATCGTTTCCTCGCTTTCTCTCTGACTCCTACCCTGCTGACCATCAGACTCGGCTGCTTCGGCCGTCCGCAATC
TCAACGACTACGAGGTCATGGGCCGCAAGCTGCGCGTCGACTTCTCCAACGAGGGTGGCGAAGACGGTCATGGCGGCCTG
ACGGGTGCATCCGGCCCCAACGACTACATCCCCTCGCTCTCCTCGGCCGCCCCGACATCGACCGGCGCTGCTTCCGCTGC
TGCTGCTGCTGCTGCCGGCACTTCCACCTCGTCCAGCACCATCGCTGCCGCCTCATCTTCCTCGCTTCTTCCACCGCTGC
CGCCTGGTCGCGATATTCCGCCCGGTGCCAGCGCCACCGACGAGATCTCCCGCATCCTCCGCACCTTGCCGCCCACGCAG
CTGCTCGACATCCTCGCCCAGATGAAGACGCTCGCCGTCGGCGATCCCGCCCGCGCCACCGAACTGCTGGCCCAGGCCCC
CCAGCTGGCCTATGCCGTCTTCCAGGCCCTGCTGCTGATGGATCTCGTCTCGCCCGAGGCCATCCAGTCCGTCGTCGAGG
TGCCTGGCTCTCTCTCTGCTGCTCCGGCCGCTGCTGCTGTCGCTGCTGGCGCTGCTCCCTACACGCCCGCACCCGCTTGG
GGACCCCCCGACGTCGCCGCGCTGTCCGCTCCCATGGCCGCGCCCGTGCCCGCTGCTGCTCCCCCGATGGCGCCCGCTGT
GGCCCAGAACCCCGACGAGCTCATCAAACAGGTGCTCGAGCTGCCACAGGCCGTCATCGACCAGCTGCCCGAGGCTGAGC
GCACTCAGCTGATGGCCCTGCGAATGCAGTATGGCGGGGGTGCCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62