GenePrediction:GLEAN_4324 Details

Name: GLEAN_4324
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:642183..641592 (- strand)
Length: 592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:642183..642145 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_179:642065..641592 (- strand)
Length: 474
>GLEAN_4324 class=GenePrediction position=GCSC_179:642183..641592 (- strand)
ATGTCTTTCCCCAAGACCATCCCGGCCTTTACCGTGAAGGTGCGCTAGTGATCACGTGACATGGTGAAATGCAATCCAGA
GCTGCAGAGCAGTCGTGCTCATGAACCCCCGCTGGCAGATCCCCATCACGGCGCCTTCGGCCATCGGTACGGCCAAGAGC
GGCAGCCTCAACCAGGTGGCCTTTCTGGTGGACCACCCCGGCGGCGGCATCACGACCGAGCCGGGATACCCGATCCAGCT
CGACGCCAAGTGGGTGCATGGCAGCGATTTCATTCGCGCCGACCCCGACGGCAAGCACCTGCGGCTGAGCGTCAACAGCG
TGCTGCAGCAGCGGGACGACCCCAGCGCCATGCTGAGCTTCAGCTACACGGGCATCATCCAGCTCGGAGGCGCGGCCGAC
AAGGTGCTGTCGGGCGCGGCCGATGCCAAGACGACCGACTTCGGCGAGGTCTTCTCGCACCACACCTTTGAGACGGGGCA
CCCGTCGCTGCGGGCGCTCGAGAGCAAGGTGTTCGTCGGCGCCGGCCACTTTGTCCTCGAGGCCGGCCAGCCGCCCGTGG
TGGAGTACAAGATCAGCGAGGTCACCCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62