GenePrediction:GLEAN_4325 Details

Name: GLEAN_4325
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:641079..636467 (- strand)
Length: 4613
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:641079..640774 (- strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_179:640700..639580 (- strand)
Length: 1121
Type: CDS
Source: GLEAN
Position: GCSC_179:639022..638890 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_179:638764..638625 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_179:638433..637542 (- strand)
Length: 892
Type: CDS
Source: GLEAN
Position: GCSC_179:637423..636467 (- strand)
Length: 957
>GLEAN_4325 class=GenePrediction position=GCSC_179:641079..636467 (- strand)
ATGTCCGACTCTGAGAACGAGCGACTGGAGTCGCCGGCCATCGAATCGCCCATCGACGCTGGCGACGACGACAACGATAA
TGTCAACGGTGATCTAGACAGCGGCGACGATCTGTTTGGCGATGGCGGTGGCGGTGATGACGACGACGGGCAGCTGAGCG
AGCACAGCCTCGGGCCCGAAGACGAGGAACCGGAGCGGTATGGCGATGAAGACGACGAGGGCGATGAGCCGCAAGTGACA
AAGGAGGAGCTGGTTATGGACGTGGACCTCTTCCGGCACCGCGTACCCAAGCCATCGGACGGGACGGTAAGTCTGAGGGT
GGCGAAGCGAGAAGCGAAGGAGCAGATGTGCAGAGTGCTGACTTGTGGCGAATGTGCAGCTGCAATCGCTACGCGTCCCG
CCATTCATCCGGATCTGCCCAGAGGAGTACGACGCCGACACGTATGAGCCGACGGCGTTTGAGCTGAAGGACTCACACTC
GCAGCACCCCAAGTCGGTGGCGCGGTTCCGGCGCGACGCGGCCACGGGCGCGCTGCAGAGCAACGCTGCCTTTTACCGGT
GGGACGACGGGTCGGTCACGCTGGCTATCGGCGACGAGCATTTTGAGGTGCTGACCAAGTCGCTGGCGCCGGCGTCGGCG
ACAGGCAAGGGCACAAGCACAAGCACGAAACCGGGGGCCAAGGCAGCAGGCAGCTACCAGGAGCTGCAGGACGCGCACTA
CTACGCGGCGGCGGCCCACCTGTCGAGCAGCCTGCTGCTCACGGTCGGCCACGTGGCCGAGCAGTACAGCGTGCGGGCCA
ACCGCACGGTGGCCGACGACGCGTTGCAGCGGCTGACCGACCGGCTGCACGCCGCGTCCCAGACCTCGGCCGGCCAGACG
ACCAACATGATGATCATCCGGACCATGCGCGACCCGGAGCTGGCCAAGAAGGAGGCCGAGCTGGCCGAGAAGGAGCGCGA
GCGCGCCCGTCGGCGGCGCGAGAACGCGTCAGCCCGGCTCGACGGTGGCTTTGGGGGTGGTGGTGGTGGCGGCAGCCGAT
CGAACCGGTCTGGCGCAGGCGCCCTGTCCATCAGCGATCTCGAGGGTGGCGGTCGGCGCGGCGGCCCCGGCGGCAGCGGA
CGCAAGCGCGGAGGTGGAGGTGCCGGGGCGCCGCGGGCGAAGCGGCGGCGACCCGAGTATGACTCGGACGACGAGCTTCC
GCACGGGGCGCGGCGCAACGACGAGTACGACAAGGAGGACGACTTTATCGCGCCCAGCGACGACGACATGTCGGACGAGA
ACGGCGGCGACGATGACGACGAGGAGGAGCTGGACGACGAGGATGACGAGGACGAGGAAGAGGAACGCCGCGGCGCCAAG
CACCACAAGGCCCGTCGGGCGAAGCGGCAGCGGGCAGCCTCGGCCGAAGACGAGGACGCGCAGGACGCCGAGGCAGACCC
GGATGATGACATGCCGGCACGGCGGGCCCGTCGGCACATTATCGACGATGATGACGACGAGTAGAGGCCTGGAGGGCTGC
GGAGGAGTGTGGGCAGTGTGTCGGAGAAGAGAAGAAGGAGCAGAGAAGCAGCCGTGTTCTTGCTGGGATATATTCAGACG
GGTGCTTTACGTGTACTTATTTGGGATCGTGTTACGGCGGCAGCAACGAAAAGCAAAAAGACAGAGGGACTACAGGGAAC
GCGCATAGACTAAGCCTCGCATTTTGAGCCAGTGCCAATTTCTATAATATTGAAGACTTGTCGAAGTAAGCGGTTCATAA
GGGTGGTTGAGTGTGTGATATTTTTAAGTTTCGACTGTTAGCAGAGCCGAATGCGGTAACATTCTCCCTAAAAGATCTGT
CCCGTATATTTTGGAGCAATGCGATTCTGCGCAGGAACAGGCCCAAGCATAAAAATTACACATGTCTTGCAGAAAACCTG
GGGCGAGCGTCTCCTCCGCATTCAATAATTAGCGGGTGCATTTTCAGTGGGGCACAAGTGTAAAACAACCACAACAGACA
TTCCCCCTCAAAGCATCAATCAACCACATGCTTGCAACAGCATGCCCTCTGCTGCAGACCGATTATCGTCAGCTCCCACC
AGCAGCGGACGCACTCAACCAAGATTCCGACAAAGCCAACGATGGCGGTAAACATTTCGCTATGGGAGACGATCACGTTT
CCGCTAGCCTCGCTGTTGTGGCTACACCGAGTGAGTGGAAGCAGAGGATTGGAAGGGAAGGAGAAGGAGGGAAAGAGGGA
AAGAGCGGAGGTGGAGAGGGTGGCTAGAGTGCAAGCCGCAAAAACTAGTGACGATGCAAACTCTAACTCTCGCAGGTATA
CGCCTACATACTCTCGTTCTTCACGCGTGACAGCACGCTCGACGCGCTCTGGGATGAGCTGCACGATGCTGAGACATTTG
AGGAGTGGGAGGCAGCTGGCTTGGCCCTAGATCATCAATACCGGATAGATACATGGTGAGTGGTGCAGTTCATGTCCTCT
CGTGCTCACTTTGTTTTGTCGTTCCCATTTCTCGATTCCTATCTTCCTTGCTGTCCTCATCTCCTCGCCTACTCCTTTCT
TCCTCTTCTCTATCTTGTTCATCCTTCCCATCTCCTCAATTTCTCGCCTCCTCGTCCTCTTATCTCTAACCTTCTTTATT
TCCCAGGCGAAAAGATGACAAGAGCAAGCTCTACGCCTGGGAGCTCATCGGTGATCGCCTCTCCGCCTTCTCCCGGGCTC
TCCGACTCGGCCACGTCCAGACGCTCGTCCACCTGCTGCAGTCGGGCCTCGTGCGCAATCTCGGCAACATCACCGTGCCG
CCGCTGTATAATGAGTCGTTTGCCGGCACAAAATACCTGATCGAGAACTACATCCTGCAGGTGTGCGAGATTATCAGCGA
TCTCGTGGCGCTGCCAGGAGACAGTCTGTCTGCTTCGTCTCCCTCCATGTCCACCACCCCCCTCCTCTCCCCAGACCTCG
ATCGCGCCCTCCGAGACGGCCGCTGCGGCCAGCTCCCAACAGCTACCCAGAAACGCCAGCTCTTCAGCAACCTGCGCCAG
TCCTTTGGTCGCACCACGCTCGTCCTCCAGGGCGGCTCCGTCTTTGGCCTCTGCCACCTCGGCGTCGCCCGCGCCCTCTT
CTACCGTGGCCTGCTGCCGCGCATTCTCACCGGCACTGGTACTGGCGCCCTCATCGCTGCCCTGATCGGCACCCACACCG
ACGACGAGCTGCCCGGTCTGCTCGATGGCGACACCATCAACCTCTCGGCTTTTGCCGGCCACGGCGACGAACCCAGGACA
GCCGATCATGTGAGGCCCTCCTCCACCTGGTGCACTTATACCCGCCTCGCCACCCTGCGCCGTCGGCTCGCCCGCTTCCG
CAGCGAAGGCTACTTTCTCGACGCCTCCGTACTCGAGCACTGCGTGCGCGATAACGGCGGCGATCTCACGTTCGAGGAGG
CTTACCGCCGCACCGGACGCGTGCTCAACATCACCGTCGTCACAGGAGGTGCCGGCGATGTGCCGACGCTTCTCAACTAT
GTGACAGCGCCAAACGTGGTGAGTTTCTTTTTTATTTGATTGCCTCGCTTCGCTCAATTTGTCACTTTTCTCTTCTAGCT
CTTTCTTTTCTCGCTTCGCTCGTCTTCTCTTCTCCTTACTCACCTCTGCTCTTCAGCTCATCTGGACGGCCGCCGTCGCC
TCCAACGCATCCGATGCCGCCTGGTACGGCCACCGCCAGCCGGCCATCCTCTGCCGGGACGCCAATGGCTGTGTGGTGGC
CTGGCCGCTGGCTGACACCGCCCGATTCCGCCATTGGACGCACGGCCGATACGACGGCACGCGTCAGGCGCCGCTGCGCC
GCCTCGCCCAGCTCTTCAATGTCAACCACTTTGTCGTCAGCCAGGCCCGGCCGCACGTCGTGCCCTTTCTCGAGCCATCT
ATGCAGTCGCCGGCGATGCGTGGTCTCGCCGCTGGTACACTAGCCCGTGCCCGCACCCTGGTCCTGCAGCAGGCTGGCCA
CTTGTTGCGTCATCGCCTCGATCAGCTGGTCCGCCTCGGCTGGCTCCCGCCAACGCTACGTCGGCTCGTGCTGGACGACG
AGCAGCAGGTGCCTCTGGGCGGTTCTGGCAGCGGTCGTGCGGCTGATGGACGCAGCCGCCGTCGCTACCAGCCCCAGAAG
CTCGTACTTGTCCCCCACGTCTCCCTACGCGACTACGTCCGCCTGCTCGACGCGCCCTCACCGGCATCGCTCCGCTACTG
GATTGGCCGCGGCGAGCGTGCCGTCTGGCCAGCAGTCGCGGCTCTCAAGATTCGCTGCTCGGTGGAGCTTGCGCTACAGC
AGGCATGTGAGGACCTTGGGGTGGGCAAGAGTAGCCCGGGTGGAGGGGGTGGAAGTGGCGGCACAGGTGCAAGCGTGGGT
GGAGAGGGTGCGGGAGGTGGATTGGGTGGAAGTATGAGCGCAAGCTGGGGTAGAAATTTAGGTGGAAATTTGGGTGGAAG
TTGTCGCATGACGCCGAGTACAACAGGCTTGCGCAGCACGGCCAGCCTCACAAGGAAGGCGTTCTTGCCAACCCTTGTTG
GGGCGTCGCGCACAACGGAACGGAGAATGGGAAAAGCAGGAGCGTCGAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62