GenePrediction:GLEAN_4329 Details

Name: GLEAN_4329
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:619909..615547 (- strand)
Length: 4363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:619909..619642 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_179:619516..617899 (- strand)
Length: 1618
Type: CDS
Source: GLEAN
Position: GCSC_179:616884..616486 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_179:616417..616305 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_179:616251..615758 (- strand)
Length: 494
Type: CDS
Source: GLEAN
Position: GCSC_179:615684..615547 (- strand)
Length: 138
>GLEAN_4329 class=GenePrediction position=GCSC_179:619909..615547 (- strand)
ATGGTCGGCCCCTCTCCCCATAGGCTGCGCCGGAAGCCGGCCAAGAAGACGGCAGCTGTCGGCACCACTACCACCACCAC
TACCACTACCTCGTCCAAACCAAACAAGAGTCCGCGCACGCCCGATGGACTCGCTCGATCGCCGGCCTTCCCGCTGGCCG
CCTTCCTCTGGCCGGCTCGCGGTGCCGCATCGCAATGGGAACTGCTGCCGCTGATCCTCATGGCTGCCGGTCTCTTTCGC
TGGGCTGCCGGTCTTTGGGGCTATTCAGGTTTGTTTTCTTTTAATCCTCGCTTCGCTCGCTTTCTCCTCTCTTCTTTCCT
CGCTTCGCTCGATCTCCCTTTCTTCTTTCCTCGCTTCGCTCGTTTTCTCCTCTCCCCCCCGCTCACCACCCAGGTTTCAA
TAAACCTCCCCTCTACGGCGACTACGAAGCTCAACGCCACTGGATGGAAATCACTACTCATCTCCCCGTCTCTCAATGGT
ACTTCCACGATCTCGAATGGTGGGGCCTCGACTACCCACCTCTGACGGCCTACCACAGCTGGCTGCTCGGCCGTCTCGGC
ACATTGATCAACCCCCTCTGGTTTGCTCTTCGCTCTTCGCGCGGACTCGAGGATCCCGCCCTCAAGGTCTATATGCGTGC
CACTGTCTTGGTCTCCGAGTACGTCGTCTACGTCCCGGCCGTCGTTGTCTTTGTGCGCCGCTTTAGTCGTCTCAGCGGCA
GCGGTGCCTCTTGGACTGCTGCTGTCGCCCTGACTGCCGTCCTGCTGCAGCCGGCCACTCTGTTGGTCGACCACGTCCAC
TTCCAGTACAACACCATCATGCTCGGCTTTGTGACGGCCAGCCTGTCCAGCATGCTGGCCGATCGACTGCTCTGGGCTGC
CGTCTTCTTCGTCGCCGCCCTCGGCTTCAAGCAGATGGCCCTCTACTACGCCCTGCCTGTCTTTGCCTTTCTTCTCGGCA
GCTGTCTGCGTGCCGGTGCTGTTCGCGCCCCAGCTCGTCTGCTCGCCGTCGCCATCGTCACTCTCGTCGCGTTTGCTCTG
CTGCTGCTGCCCCTCGCTCTCGGCACCCTCTCGGATCTCCGTGCCGGCGTGCATGCCCGCCCGGAGCTCGCACCCGACGC
CGCAGTGCCGCCACTGGCCCTGCCCGTCCTCCAGCAGCTCGTCGACGCCATCGGCCTCCGCTGGCCAGCTGCAGCTGCCT
ATCTGCAGCCCAGCCTGTCGTCGCCCCCCTACGCCCTTCTCGAGCAGCTCGCTCAGCTGATTCACCGGGTCTTCCCCCTG
GCTCGCGGCCTGTTCGAGGACAAGGTGGCCAACTTCTGGTGCGCGGCCAACGTGCTCGTCAAGCTGCGTGCCTATCCAGA
GGCACTGCTGCAGCGACTCTCGCTCGCCGCCACGCTGGCAGCCGTGCTGCCACCGAGCGCCGTCTTGCTGCTGCGGCCGC
GGCGCCTGCTGCTGCCGCTCGCTTTTGCCGCGTCGGCCTGGGCCTTTTTCCTCTTCAGCTACCAGGTGCACGAGAAGAGC
GTGCTGCTGCCGCTGCTGCCGATGACCCTGCTGCTGGCCGGCGCCGGCGGACTCGGCCGCAACACGCGCGCATGGGTCGG
CTTTGCCAACCTGCTGGCCGTCTGGACGCTCTTCCCGCTGCTGCAGCGCGTCGACCTGCGCGTGCCCTACGCCGTCTTGA
CCCTGCTGTGGGCCTTTCTGCTGGGCCTGCCGCCCACGTCCCTGTCGGTCTACGTCGGCCCCGGGCCTGGTCCCGATGCG
GCAGCTGATCCGGCCGGTCCTGGTGTCCTCTGGTCGGCCACGCTGCTGCACGCGCCCTTTTACCTCGCCATGGCCGTCTG
GCACGTCCTCGAGCACTTTGCCGCTCCGCCGCCCGACAAGCCCGACCTCTGGGTCGTGACCAACGTCGGCATCGGCGCCG
CCGGATTCGGCCTCTGCTACCTGTGGTGCATGTGGCGGCTGCTGGTCGAGAGCGAACTCTTAGGGAGCGGTCCAACCACG
AAGAAGACGCAGTGAGCGGGGGGGTCGTGCATTTTTTCCTGTCTTAATATTGGGCTGTAATATACATGGATGTAAGCACG
AAGAACAGCGGCTTACGCGTTTGAAGAATTACGTAATGGGAGTTTAGACACCCAAATAGGCATTTGGACTGCCATGTGCT
TTGTCTGCGCATCCTTTCGGCGCCACACTTCCCGGTTGCGTCCGTGGCAAGGAAAGAGGGGTTTGTGGCCGTGGCTGCCT
GTGACGGACGGCAGGACGACAAGACCCAGAGACGGACGGTGGCGAGGAAGAACAAAACACCGACACGCCTTGAACAATAG
CCGCTTACGTAAGCATAGTGGCGATGCGAACAAGCATAAACCATTAGGTCACGATGCTTATGGGGATTGGGAGGGACCGG
GTCTTGTCTAATTTGCGAGTACGAGTACCCGTACCCGTACTCCATACAGTTTGTACCCTATTACTCCGTATAGCCTCGCA
CTCCCTCCGACACGAGCAGACCTCGTGCTCTGTCTGTTCTGAGGGTTTGGAAGGGAGAAAACAGAGTTGCACTAATGTTT
TAAAGTCCCCACATCTGAGCTATTAGCTGATGGGTGTGGGCACGAGCGCAAGTATCCCGGGCCCAGAAGGACTTGGCAGT
AGGCCGTACGCAGGGCTACGTCACAGGTACACATGCCACATTCGGTACTTGCGGCCCCTACCTGCCGAACTCTACCTAGG
CCGCCAGAAAGGACACATTGTAATAGGGGCGTTGTAGCACTGGCAGAGCTCACGTTTTCTCCTGCTTTCTTGCAAGTCGA
GCATCGGCTGCCGTCTTGACAGATTACACCACGAAGCGTACGAGGGACATTACCAGACGGCTTCGACCATACCCGCACCA
CTCGTCCTCCGCACGTTGTCGCTGACTCGTACCTCGCCTCTCTTTCTTCTCAGACACTGTGTGTCTCTGTCATATTGATG
TATATATAGACTCAGCGTATTTTCTCTTACGTCCCATCCTCCTTTTTCTGCCGGCCTCATCCTAGCCTCTTCTTCTCGAC
CCCTCGCGCGCCAAGAGGTGCCTTCAACGAAAAGCGAAACAGCCAAAAGCAAAAAGCAAAGACAGATCTACGAATCAACA
CTCCCGTTCGAAAGCTCTCTGCTCATCGTGCACGATCCTCGGGACACGTCGTCCAAGCTGACAGTTGGAGACGGAAGCTC
GCCTTTACGCGCCTCGACTTCTCGACGTCCAACTCCTACCCCTACCTCTCCCCCAACATGGCTCACATGCGTGGAAGTGG
CGCCGGCTACGGCATCGGCCAGGCGAATCCGTTTGGCAACTCGCCCGACGTGGACACGGATCCGTCCGGTCCGCTGGACG
CGATCCGCCAGCAGACGAGCAAGATTGAGGATCTGCTGGACACCTACAGCGAGCCGGTGAAGCCGTGGGTCCCCTCTCGC
CCCTGGATTGTCGCGGCTGCACGGCCCCCTGCTCTTGCTGACGCGGTCACAGGTATCTGCCGGCCATTGGGCGGTTCCTC
ATCGTGGTGACCTTTCTGGAGGACGCTCTGCGCATCATCACGCAGTTCAGCGACCAGCTGCGGTACCTGAGCGAATACCG
ACACAGTGAGCTTTTCCCTGTCTTGTTCTTTCTCTTTCTCCTCCACTGACACCTGCAGTTCCCTGGGGCCTCACGCACCT
CTTTCTCGTCGGCAACGTGCTGGTGATGGCGTCGTGCTCGACGCTGGTGATCATGCGGCGGCACTCGGGGTACGCGGTGA
GCGGACTGATCGGCGTGGTGGTCAGCCAGGCGCTCGGGTACGGGCTCATCTTCGACCTCAACTTTTTCCTGCGCAACCTC
TCGGTCATGGGCGGGCTGCTGATGGTGCTGTCGGACTCGTGGATCCGCAAGACGCAGGCGTTTGCCGGGCTGCCGCAGCT
GGAGGAGAAGGACCGCAAGATGTACTTTCAGCTAGCCGGCCGGGTCCTGCTCATCTTCCTCTTCATCGGCTTCGTCTTCA
GCGGCGAGTGGACGATCGGGCGCGTGCTCGTGTCGCTGGTCGGACTCGTGGCCTGCGTCATGGTCGTGGTCGGTTTCAAG
GCCAAGGCCAGCGCGACGCTGCTGGTGGTGATCCTGAGCGTGTTCAACGTGCTGGTCAACAACTTCTGGACGGTGGGTCT
TTCTTGGTTGTCTCTTGTCTGTTGTCGGTCGTCTGTGTGTCTTCTGCTAACTTGCCGACGCCCAGCTCCACGATCACCAC
CCCCACAAGGACTTTGCCAAGTACGACTTCTTCCAGATCCTCTCTATCGTCGGCGGTCTCCTGCTGCTCGTCAACAGCGG
CCCCGGCAAGGTCAGCTTCGACGAGAAGAAGAAGGTGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62