GenePrediction:GLEAN_432 Details

Name: GLEAN_432
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1728100..1730010 (+ strand)
Length: 1911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1728100..1728111 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_167:1728447..1728470 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_167:1728565..1728590 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1728666..1728707 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_167:1728768..1730010 (+ strand)
Length: 1243
>GLEAN_432 class=GenePrediction position=GCSC_167:1728100..1730010 (+ strand)
ATGCGTGAAATCGTAAGTTCGACCCCTGTTTGCTTGCTGCCGTTGTCCCCTCCAGCAAAGGCCTCACCGTCTCTTCGCGA
TGAAGACGGGGTCGAGATACGGAGACGTGAGACGGACGGAGTCGGGCTTCGGTGCCTGTCCGACATCGTTTGCACTCCGG
GTTTTTGACCCGTTTGCTTGATCTTGATCTCGAATCTCGTTGTCGATGGGCCTGGGGAAGGGACATATCTGTGTCCACTT
GACTTGCGACCTGGAGACAACGAGAACATTTCTTGATAGCAGAAGTGCCAGCTGCCTTCACGTTGTGTCCTACACAGATT
CGAGAATCTCAACTAACGTTTTAACAGGTCCACCTCCAGACTGGCCAATGCGTACGTTTCGCCCTACTCCGAATCAATCG
ACCCCTACAGGCCCCCAGGCTCCGACGAAACAAACCTTAAACTGACACGGGCTATGGCATAACAGGGTAACCAGATCGGT
GCCGCTTTCTGGTAAGTTTTATCTGAGCTATAAATAACGCATCTGGGCAATCAGCTTGAAGTGACAAATTCTAACCTACT
TCACAGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGAGTGTAGGTTTCCGGTTTCGGAAGAGTCTATTGTG
GTGTATATCATCTAATATGTTCTATCAGGTACAACGGCACGTCTGAGCTCCAGCTGGAGCGTATGAGCGTGTACTTCAAC
GAGGCCTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACAATGGATGCTGTGCGCGCCGG
TCCTTTCGGACAGCTCTTCCGGCCTGACAACTTCGTTTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCACT
ACACGGAGGGTGCCGAGCTTGTGGACCAGGTGCTCGACGTCGTCCGCCGCGAGGCTGAGGGCTGTGACAGCCTCCAGGGC
TTCCAGATCACGCACTCCCTGGGCGGTGGCACGGGTGCCGGTATGGGCACCCTGCTAATCTCCAAGATCCGCGAGGAGTT
CCCCGACCGGATGATGGCCACGTTCTCGGTGATGCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCGTACAACGCGA
CTCTATCGGTGCACCAGCTGGTGGAGAACTCGGACGAGACGTTCTGTATTGACAACGAGGCGCTGTACGACATCTGCATG
CGTACGCTGAAGCTGCCGAACCCGTCTTACGGCGATCTGAACCACCTGGTGTCGGCGGTGATGTCGGGTGTGACGACGTG
CCTGCGATTCCCGGGCCAGCTGAACTCGGATCTGCGCAAGCTGGCGGTGAACATGGTGCCGTTCCCGCGTCTGCACTTCT
TCATGGTCGGCTTTGCGCCGCTGACCAGCCGGGGTGCGCACTCGTTCCGGGCGATTACGGTGCCGGACCTGACGCAGCAG
ATGTTTGACCCGAAGAACATGATGGCGGCGTCAGATTTCCGCAACGGTCGCTACCTGACGTGCTCTGCCATCTTCCGCGG
CAAGGTGTCTATGAAGGAGGTGGAGGACCAGATGCGCAACGTGCAGAACAAGAACTCGTCGTACTTTGTGGAGTGGATCC
CGAACAACGTGCAGACGGCGCTGTGCTCGATCCCGCCGCGCGGCCTGAAGATGTCGTCGACGTTTGTCGGCAACTCGACG
GCGATCCAGGAGCTGTTTAAGCGCGTGGGCGACCAGTTCACGGCCATGTTCCGGCGCAAGGCTTTCCTGCATTGGTACAC
GGGTGAGGGCATGGACGAGATGGAGTTCACGGAGGCCGAGTCCAACATGAACGATCTTGTCTCAGAATACCAGCAGTACC
AGGATGCCGGTGTGGACGAGGACGAGGAGGAGTACGGTGTTGAGGAGGATGGTGTTGAGGAGCACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62