GenePrediction:GLEAN_4331 Details

Name: GLEAN_4331
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:608440..607773 (- strand)
Length: 668
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:608440..608348 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_179:608283..607898 (- strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_179:607836..607773 (- strand)
Length: 64
>GLEAN_4331 class=GenePrediction position=GCSC_179:608440..607773 (- strand)
ATGGAGGAAGAGCGCCTGTGGAAGTTTCACTTGCCGCCTTGGGTCTCGGGGATCGCGGCGCGCAACGCCGGCGTGTATCT
GTCGGGAGCTCTGGTGCGTATCTGTCCGGAGGCTGTGAACAACCAAATTCATCTCCGCTGACGCGCCCGATTCCCAGTTC
TCTCTCGCCTTTTATGTCCTCCTGGACGCGGCCGTGTGGTCCAAGTCGACGGCCAACGGGTCTAATGTGCACGTCACGTT
TGTCGACTGGCTGCCGCTGATCTGCAGCAGCCTGGGCATGCTGATCATTAACTGCGTCGAAAAATCCCGGCTGTCGTCGG
ACAGCTTTGGCTATGCCGGCATCGGCGGCGGCGGCGGCGGCGGCGGCAGCAGCGTGGCCTGGCAGGCCCGCGTGGTGCTG
TTTCTCGGCTTCGCCAGCCTGGCCGGTGGCATGGCTGGCGGCGTCTGCATCTTCGTGCTCAAGTTTGTCGTGCCCAAGGT
GGCGATGCCGATGTTGTCGATGGGCGTCGAGAACGTGGTGGCCAACGGGCTGATAGGACTGAGGTCTGTATTTTTGGGGG
GGTTCTTCCCTTTCACCTGGGCTTCACTCAACTGACATCCACAGCTCCGTCATTCTCTGGATCAGCCAGAACATGGAGGA
TGAGTACGCGTACAATCTCGCTCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62