GenePrediction:GLEAN_4334 Details

Name: GLEAN_4334
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:580861..579853 (- strand)
Length: 1009
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:580861..580816 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_179:580703..579853 (- strand)
Length: 851
>GLEAN_4334 class=GenePrediction position=GCSC_179:580861..579853 (- strand)
ATGGCAGCTAAGCCCAACTCCAAGTCGCCGACCATTCGGCGGATCCGTACGTGTTCCGTGGTGTCCATGACGCACATGAC
ATGACGTCTGCGAGGCTCCATGGCCCGCTTCTTCCCCCTTGTCCGGTCGGGTTCGTGCAGCTGACCGCGTCCCCCTAGTC
CGTGAAGCCCAGGAGCTGGCGGCGGCGCCGTCGGCCGACTTTGCAGCGGCGCCGCTCGAGTCGGACCTGTTTGAGTGGCA
CTTTACGCTGCGCGGACCACCCGGAACCGCGTACGCGGCCGGACAGTACCACGGGCGGATCGTGCTGCCGCCGACGTATC
CGCTGCGGCCGCCGTCGTTTCGATTTGCCACGCCGTCGGGCCGCTTCGAGGCCAACCGCGAGATCTGTCTCTCCATCAGC
GGCCATCACGAAGAAACCTGGCAGCCGGCCTGGGGCCTCCGCACCGCCCTCGTTGCCCTGCGCGCCTTTATGGAGACGGA
TCCGGCCGGCCAGCTCGGCGGCCTTGACGCCTCCGACGCTACCCGTCGCAGCCTCGCCGCCGCCTCGCCCGCCTTTCGCT
GCGCTGTCTGCGGTCGCTCCAACGCCGAGATCCTCGCCGAAAACGCCGCCGCCGAGATTACCAGCCCGAGCCGAGCATCG
ACCGAAGGGACTGTCCAGGGTGAAGGCTCTAGTGCTACTGCACCTGAGATCCCCCCCGAGCTCAAGCTCGTCTGGCGAGA
TGAGCTCGACGCGGCTGGCACGACCAACACAGCAACTCCTCCAACAGAAGCTGCAGTTCCTCCAACAGAAGCTGCAGCTC
CTCCGACAGAAGCTCCAACAGCTCCTCCAGTTCCAGCTCCTCGTCCATTCCTTCGGCCCACTCCCACCGTCCCCCTCCCT
GCTGGCCCCCGCGGCCTCCCCCTTCCTCCTCGACGACAGTCCGCCGACATGCCGGTTTGGGTCGACCGCTGCATCGGCGC
TCTCCTTGTCGTGCTGGTGGCCATGCTACTCAGAATGGCGTTACGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62