GenePrediction:GLEAN_4335 Details

Name: GLEAN_4335
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:570924..569498 (- strand)
Length: 1427
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:570924..570592 (- strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_179:570473..570338 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_179:570308..570160 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_179:570058..569498 (- strand)
Length: 561
>GLEAN_4335 class=GenePrediction position=GCSC_179:570924..569498 (- strand)
ATGGTGCAGAATGCCGACAAGGTGCGGTGCGCCTTGTTCACGGTCGAATATAAAGCAGGACACAAGTTGATGCCAGAGGC
ACTGATGGCAACGCTGGACGGACGACTGTCCGATCAGGTCCTTTTTGCCGATGCGGCTGAGGCAGCACGTCTTACAGAAG
AGAAACGCCAGCGAAGCAGGCTTGGGGATGCTGCTTCTGCAGAGGAAGAGGGCGCAGAAAGTACAGTGGATATTACCACG
GAACAAGAAAACAACGAAACATCGCCATCACCATCCCTGAAAACAGCTCGGAATCGAACAGCGCAGATCTTGACGCAGGC
ATTCCATTACATGGTTGGTGGACAGCGGGCTGGCCTACAGCTATGTATCGACTGGCGAAAGCCTAATTTTTCTGCACGTC
AATTATGACGACGACCCGTCGGTCTTGTACTATCATCTCTCTGTACCAAAGAAGGAGATCCACCTGCCCGAGCTGCAAGA
GGAGGACGTTGTAGATCATGGGTCGATACAACACAGCGCTGCCACGGCAAGGCAGACGCCTGTAGCACTTGTCCTGACGC
TTATCCTCTTGGCGCTACAAAAAACGGGTTCGAGCCTTTCCCAACCCATATAACAGCACCGCAGAGGCACCAGGCCCGAG
CCAAGCAGCAAGTACTAATCCCGCCCAGCAAGGGGCCAGACAAGGGGGTGGACAAAGCGGTAGCAGCATCGAAGCTCACA
CCGCGCGCCTACCACAACAATCATACTGCACGCAAAAGTGCCTGCGTGGGTTGAAGTCCGGCCTTGCCCTAGACCATGCC
TGTCCCAATATAGCACCGCACCGGTGCTTGGGTAATGAAAACAGGCACGGGATTACCCATGCACAGCTGCTGTCGGCGGT
CAAGGAGCAGCTAACCAGAAACCTCGACGACGGCTGCGCGGCCCTCGACGGACACGGCAAGTTTGGGGCCATCGGGGCGC
TCTTCAGGGTGACAGCATATCCGCAGGGATACACGTTTGTGGCCAAAGGCGTCCAGGACGACGACCGTGAAAGCCTGGAC
CTGGAGAATCGAGTATACCAACAACTGGCAGTGTTGCAGGGCAGTGTTGTGCCGGTATGCCTCGGCCTGGTGGACCTGCG
ACGGGCATACGTGCTGACAGGCGGAGCACGAGTGTTGCGGCTGATGCTGCTGTCGTACGCGGGCGAGAGGGCGCAACCAG
AGCAAGTAAGCGAAGAGGTAGAAAGGGAACTGGAAGGGACGCTGCGGACACACGGTGTTGAGCACGGCGACCTGCGGCTG
GCCAACGTTCTCTGGAGCGAGGAGCTATGCAGGCTGATGGTGGTGGACTTTGACCGGGCGACGTTGCACACAAAGCGGAA
AAGGGGCGTGGAAAAGGAGCTACAACAGGACAAAAAGTCGAACACTGCTTGGGCCAAGGTCGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62