GenePrediction:GLEAN_4336 Details

Name: GLEAN_4336
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:564025..562670 (- strand)
Length: 1356
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:564025..563733 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_179:563663..562670 (- strand)
Length: 994
>GLEAN_4336 class=GenePrediction position=GCSC_179:564025..562670 (- strand)
ATGGCGTACTCATCCAGCTTGCCTGTTGCAGCCACCTCCTCCCTGGCTACGGCAGCATCTCCCTCAGCTCCATTACCAGG
AACTCTCCCGCAAATAAGGTCGCGGGGCCTCTCGTGCGTCTATGAGATTGCCAGTATCCTGACGGGCTCCTCTCGACGTC
GACGAGGTGGCGAGTATGAGCCGCTGCTCGGCCGGCGCGTGTTTGTCGATGTGGAAAATCTAGGCTCTAAGCCTCTCAAA
ACCCATCGGCGACAATGGGTGCTGTGCGGCACCGTCTACGGCCTGGTTCTGCTGTGAGTCTCCCTGCGCTCTCTCTCCTT
GTTTTCACCATCTCCGTCTCTGCTGCTGACGGGAAGAAACAGCACCGTGCTCATCGTCCTGAACGCATCCCTCTTCGTCT
GGCAGCTCGCCTATGCCATGCGGTCGGATCCCGACGCCATCTTCAGTTCCTGGGGGCTTCCCGGCACCGGCACCGAGCAC
CTGGCCTGGTACCCGACCGACTTTCTGCGCGACGTCATTCCCGTGCCGTGTCACTCGCACAACGACTACTGGCGCAACGT
GCCACTGTTTTCAGCCCTGTATGCCGGCTGTGTCGGCGTCGAGGCCGACGTCTGGCTGCTCGACGGCTACGAGGACGAGC
TGTACGTCGGCCACAGCCGCGCCGCCCTGCAGCCGAACCGCACTTTCCGGTCGCTCTACGTCGACCCGCTGGTCGAGATT
TTGGCGCGTCAGAACAAGGACCACCACTACTTTTCGGGCAACGACAGCAGCAGCAGCGTTCAGCCGCGCGGCGTCTTTGA
CATCCGCCCCGATCAGACGCTCGTCCTACTGGTCGACATCAAGACGAGCGGGCCCGAGACCTTCCACAAGGTGCTCGAGG
GGCTCGAGCCGCTGCGGTCACGCGGCTGGCTGACGACATACCGCGACGGCCGCCTGCACCAGGGGCCCATCACCGTCGTC
GGCTCTGGTCGCACACCCTTTGCCGACGTCGTGGCCAACAGCACGTATCGCGACGTCTTTTTTGACGCGCCGCTTGACCG
GATCGAGAACAGCCAGCAGTACGACCAGACGAACTCGTACTACAGCAGTGTGGCCATCGGCGAGGGCCTCGGCACCATCT
GGTTCGGCATCTTCCGTGAGAGCCAGCTGCAACTGCTGCGCCACCAGGTGCGCCAGGCCCATGACCACGGCCTCAAGGCC
CGCTACTGGGACCTGCCGGCCTGGCCCATCAGCGCGCGCAACCGCGTGTGGGACACGCTCGTGAGCGAGGGCGTCGACAT
GCTCAACGTCGACGACCTCAACGGGGCCACCAAGAGCAACTGGGACGACGCCGGCTGGTTCGGACGGCTACTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62