GenePrediction:GLEAN_4337 Details

Name: GLEAN_4337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:562149..557418 (- strand)
Length: 4732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:562149..561048 (- strand)
Length: 1102
Type: CDS
Source: GLEAN
Position: GCSC_179:560986..559731 (- strand)
Length: 1256
Type: CDS
Source: GLEAN
Position: GCSC_179:559379..557418 (- strand)
Length: 1962
>GLEAN_4337 class=GenePrediction position=GCSC_179:562149..557418 (- strand)
ATGGCTGACAACAACGACCAAGAATTTTCGTCGACCTCCTCAGCGGTAGCTGTTAGCAATGCCATGGCGAAAGCTGGAGA
GCCGAGCTCTGTCGCAGAAACTTTCCCATTTGCCCCGCGCCGTCAGAAATTGAAGCAAAAAGCTATGCGTTTATTCAGGC
CCAGGAATATGCCACCTAAAGCAAAAGCTGTTGCCAATACCATTGTCTATACCGACCAGCAACGAGCAGGCCCAAGCAAA
ATTCCCAACCCGCCAGAGGAGAGCAGCGTGCCTGTGCCCTTCCCGGATGGCATCAAAGTGCTACACGACTGCTCCGATGC
TAGAGTTGATGTCTGCTTCATCCATGGGCTGTCTGGTGACAGAGAAAAGACCTGGACTGCTGCAGGAGAGTCTCAGCCTT
GGTCACAAACCCTTCTTCCTTCTCGTCTCCCTGGCGCCCGCATTCTCACCTATGGCTACGACGCATACGTGGTGCGCGTA
ACCAGCGCGGCGAACAATTCGCTGACCAACCATGCCACAAATCTTCTGAAAGACCTGACGGATGACAGAGCGGCTTCCAG
AGCGTCTTCACGGCCCATCATCTTTGTGGCCCACAGTCTCGGTGGTATCGTGTGCAAGAAGGCCCTCCTGCTTTCGCGCA
ACAACCGTGATGCCCACTTGCAGAGCATTTTCAAGTGGACCAAAGGTGTAGCATTCATGGGCACTCCACACAGGGGATCC
GAGGTGGCGGACTGGGCCATGCTACCCGCTTCGGCTCTAGGATTCATGAAGACTGTCAACAAGACGCTCCTCGAGGTTTT
GCGGACAGACGACGTGATGCTCAAGGACACTCGGGAACAATTTGTGGCAATGATTCAGGACTTGGTCTTGAATGGCCGAA
TTGTCGAAATTGCGTGCTTTTGTGAGGAGCTGCCTATGAGCAACCTTAAAAAGTTCATTGTCACTCAGGACTCAGCCACG
CTCGAGGGCTACAATGCGTTCACCATCCACGCCGACCATCGCGGCATGGTGCGGTTTCGTTCCGAAGACGACAACGGCTT
CAAGAGGCTGTTAGGCGACCTGGTCCGGTGGACCTTACCGCAAGAGCCAGTGGTTGAGATTCGTAAGAGTCATCGCCATT
ACACTTTTAAATGACCCCCTACCTAATTCTAACGATAGTCTAGCTCTGCAACCTGTGCTCTCAGAACTTGACAAGGATTG
TCTAAGCTCGCTGGCTTTTCCGAAAATGAACGATCGCATGAACGACATTGAATCCGCCTTTGACAATACATGCAATTGGC
TGTTCCAGCATGAGACCTACAGCAGCTGGGAAGCCACCGATCGAGGTCTACTTTGGATCAAAGGAAAGCCAGGCTCTGGA
AAGTCTACCTTGCTACGACATTCCCTTAACAGAACCAACAAATTGCCACCCTGTGGAAGCCAGCCACCCCTCATTCTCTC
CTTCTTCTTTCACGGCCGTGGCGAGGAACTTCAAAAGTCCCCTCTAGGTCTCTTTAGGGCGCTGCTCCATCAGATACTTT
CGCAGGCACCAGATGCAGCAAAAGACCTTGTCGCCACTTTTCAGGACCGGCGCAACACCATGGGCTCAGCAGGCGGACAG
TGGAAATGGCATGCTCGCGAACTACGGGATCATTTTCAAGCGTCTTTGCCGCAAGTCATCGAAAGCCGGACCGTCTGGAT
ATTCGTCGATGCCCTCGATGAGTGCGGCGAACAGAATGCAGTTGAATTGGCTGGACATTTCCAGCGCATCCTCTACCAGC
TTCCCCCGACGGCTGGGCAATGCCGCATTTGTTTCACCTGCCGTCACTATCCCATTCTCTCTCTAGACCCTGCCACCTTT
GAGATATGTGTCGAGCAAGAGAACGGACTTGATATTGAGACTTACGTATACAACAAGTTCTCTTCTTTCAATGTCCCAGC
TGAAATAGTGGCAACCATCACGAGCCAAGCATCCGGCGTGTTCATGTGGACATATCTTGTACTCAACACTGTTCGGGACT
TGTTGCGTGGGGGGGCAGGGTGGAAGAAGATTGCCTCCAAGATATCCGAAACTCCCCAAGATCTTGATACGCTTTACGAC
GAGTTGGTGAAGAGCATGGATGACACGGAAGCCTCCCTGAAGCTATTCCAATGGATCTGCTTTGCCAGACGGCCTCTTTC
GTTAGATGAGCTACGATGGGCTCTGATCCTCGACCCAGGTTGCTCTTACACATCGGTCCAGCAATGTAAGAGTGCAGATG
AGTACGAATGCGATATGGAGAAGCACCTGAAAACTCTCAGTCGTGGTCTTGCCGAACTCACGCAGTCATCCGATGAACCC
GTTGTGCAATTCATTCACCAGTCAGTACAGGATTTCTTCGTCAACAAGGGCCTACTGTCTCTACATAACAAGAAATCGGA
TGCTGCCGAAACGGTTACGGTTGATTCAATAGCTGGGATGGCGCACTACCAATTGTCCAGAAGCTGTATTCGCTACTTGG
CGATGGACGAAATATATGACATTGGAGACTGTAACGACACCCTTGAATTTCCACTGTTGCTTTACACTGTATCGCGCCTG
TCAGAACACATTAAAGAAAGTGAAGCACAGAACACGACTCCGGATGACCTCCTATCATTCTTTGGTTGGCCATCAGAGCA
TCTAATACAGTCATGGGGTCGAGTCTCTACGGCATGCGGAAATTCCTTTAGAATATATATACCATGGCTAAATCGAAAAT
CAACAATGCTACATCTATCAGCACAGCATCAACTTACCAGACCATTACAGGTAATCCTTCAAGATACTTCCGCAGACGTC
AATGCCACAGATGGAATCGGTCGCACGCCGCTGTCGTATGCGGCCTATGCTGGCAATGAATCGACTGTTCATCAAATACT
TAAAATAGGCAAGGTAGACGTCGATTCAGAGGATCAATACGGCTGGACGCCGCTCTTTCTAGCAGCCAGATATGGGCACC
AGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTCAAAGGATCGAGACGGCCGGACGCCGCTCTCT
TGGGCAGCTGAAAATGGTCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTTAAAGGATCA
TTACGGCCGGACGCCGCTCTCTTGGGCAGCTAAAAAGGGTCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGG
TAGACGTCGATTTAAAGGATCGAGACGGCCGGACGCCGCTCTCTCGGGCAGCTAGATATGGGCACCAGACGGTGGTTAAG
CAGCTGCTCGATACAGGCAAGGTAGACGTCGATTTAAAGGATCATTACGGCCGGACGCCGCTCTCTTGGGCAGCTAGATA
TGGGCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTCAAAGGATCGAGACGGCCGGACGC
CGCTCTCTTGGGCAGCTGAAAATGGTCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTTA
AAGGATCGAGACGGCCGGACGCCGCTCTCTTGGGCAGCTGAAAATGGTCACCAGACGGTGGTTAAGCAGCTGCTCGATAC
AGGCAAGGTAGACGTCGATTCAAAGGATCGAGACGGCCGGACGCCGCTCTCTTGGGCAGCTGAAAATGGTCACCAGACGG
TGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTTAAAGGATCGAGACGGCCGGACGCCGCTCTCTTGGGCA
GCTGAAAAGGGTCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACGTCGATTCAAAGGATCGAGACGG
CCGGACGCCGCTCTCTTGGGCAGCTAGATATGGGCACCAGACGGTGGTTAAGCAGCTGCTCGATACAGGCAAGGTAGACG
TCGATTCAAAGGATCAAGGCGGCTGGACGCCGCTCTCTTGGGCAGCTGAAAATGGGCACCAGACGGTGGTTAAGCAGCTG
CTCGATACAGGCAAGGTAGACGTCGATTCAAAGGATCAAGGCGGCTGGACGCCGCTCTCTTGGGCAGCTGAAAATGGGCA
CCAGACGGTGCTATCCCTATTAATGCAAAGTGGTGGAGATGCTAAGCGTGGCGACAATGTTGGGCGCAGCCTGCTGCTAA
TTGCCGCAGAGAACGGAGACGAGCCGACAGTACAGCTTCTCTTGTCTGCGACGACTAGTCTAGACAGCAAATCCTCACAG
ACCGGGACTTTGCCAATGACGCTGCAACAAGTCGTGCAGGGCGAGCTCGAAGCCATGGTGAGCTTCCTCTCTCAGGTCGA
CGCCAAGTCCGGGGTTGATGACAGGCGGTATGAAACGGCGCTGGTATGGGCCTCAAAGGCCGGATATACAGACGTCGTAC
AGCTGCTGTTAACGATGGATGGAATCGATGTCAATCACAAAATAGATGGTGAAACGGCGCTGCTACAATCAGCGAAGAAC
GGTCGGGTGGAAGTAGTGAAGCGGTTGCTGGCTGCAGACGGCATCGACGTTAATCGAAAAAGCTGGAAGGAGCAAACGGC
GCTAATGAGATCCGCAGAGGAAGGGCACACGAGTGTGGTAACGCTGTTGTTAACAGTAGACGGCATCGACATTGCTTGCA
AGAGCCGGTACGGTATGACTGCGCTGGACCTGGCTGCAAAGGGAGGCCACTTGGATGTGGTGGAGCTTCTTGAGCAAAAG
CTGCACGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62