GenePrediction:GLEAN_4338 Details

Name: GLEAN_4338
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:556882..555802 (- strand)
Length: 1081
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:556882..556847 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_179:556683..556241 (- strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_179:555811..555802 (- strand)
Length: 10
>GLEAN_4338 class=GenePrediction position=GCSC_179:556882..555802 (- strand)
ATGCCTGAACAACAGAAGCTGCTTGCATCGCTCGACGTGAGTTTATTCCTCGTTCCCATTGCCATCGTCGTCCGTCATTG
CCGATATCATTGAGTGGCTGCTGCTCAGTTCCGACTGGTGTTCCCAGCTGCGGCCGCTCTTGATGACGGCAAGACATCGA
CAGCCTGATCGTGGCAGTGTGCTAACAATCCCCCCAAAGGACTCCATTGCCTCGCGGCTGCCATCGCACTCGCAGCAGCT
CTTCCAGGCCAAGACCGCCCGCGGCCTGACCTTTGCCGAGCTTGCCGACGCCCTCGGCCGCAGCGAGGTGGCCGTGGCAG
CCATCTTTTACGGCCAGGCGTCGCCCTCGACGGCCGATGCGGCCAAGCTCAAGGAGCTGCTGGGGCTGACCGACGAGCTG
ACGGCACAGCTGACGGCGGCGTCGTTCCCCGACCGCGGCCGCGCGGGTCCGATGCCGCCGGTCGAGCCGCTCATTTACCG
GCTGTACGAGATCGTGCAGAACTATGGGTATGCGTACAAGGCTGTGCTGAACGAGAAGTTTGGCGACGGGATCATGAGCG
CGATCGCCTTTAGCACGGGCGTTGAGAAGGAGGTCGACGCCGAAGGGATCACCTGGGTGAACATCCGGATGCGTGGGAAG
TGGTGAGTTTGGGCCCTGTCGTGGTCTTTTCCGTGCTTGTTGCAGTCTTTGGTCCTTTGCTAACAGGCAGGCTTCCGTTT
TCGCGTTTTTAAGCAACGGATCAGATTTGGTGGAAAGGCGAAACATCAGAAGGCAATTTCAAGAATGCGTATGTAATCAG
AAATGTACCAACGGAAGCCACATGCAGAGACGTGACTTCCCTTTGCTGTCCTCCATCCAGACCGGTCGTTCGATCCAATT
GTCCGTTGCAAAATAAAAATGAATAAATCGAGCGGAAGCTTCTTTGATGTGATACTTTGCGGGACAAGGCGAGGAAACCC
AGGGGACAATACTAAGAGTGGAACAATAGCAAGGCTAAACCCGTCACAGCCTCGCTTGTGACTGCCAACTTCACCACCAC
ATCTGCCAACAGCTATGACTTCCAACTACAGCACGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62