GenePrediction:GLEAN_4339 Details

Name: GLEAN_4339
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:554887..552220 (- strand)
Length: 2668
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:554887..554799 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_179:553728..553476 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_179:553399..552625 (- strand)
Length: 775
Type: CDS
Source: GLEAN
Position: GCSC_179:552566..552220 (- strand)
Length: 347
>GLEAN_4339 class=GenePrediction position=GCSC_179:554887..552220 (- strand)
ATGCAGCCCAGCTTTGTCAAGAACGTCCAGACGGTGAAGGCCAGCGCCGGCGGTGACGGCCTCATTGGTGGCGGTTACTG
CGTCGTCATGTAAGTTGCCTACTCTTGAGGCAACTTGCTTGAGATGATGAGAGGAGAAGCTCGAGAGAGGCAAAACAACC
ATGTCACAGACTACAATCCACAGCAATGCACCCCAATAGCGAGGATTGGGCTCCCCTTGTCTTTCCAGCTCTCTCTACCC
TCCTCTACCAGTAGGATACCTATCCTTGACAGAAAAATCATCACAAGACGACATATCGACCCATCTCCTGAATCACTGAT
CTCTTCTCGCTCATCTTTCTTTTCTCGCCAACGGAGGAACTCATTTGACAAAATCGATTTTCTCCACACACCGGCAACCT
CATTTGGTATACTTTACACAGTACTCACAACTCTCACTTGCCTTCGGTTTATTCGCTTCATCCTACTGGTGTCTGGTTCT
TGCTTATTCTGTGATCTCTTCTGAGTGGAATGGCCAACCATTCTGATCGGACGATCCCATAAGAGGTGGGAACGAAAGCA
CCAGGAGTACGAAACATTTTACTATCATGGCCTGCTGTGTATACGCACACTGGGTTCTTTCCATTTGCTGTGTCAATATT
TTCTGGCCATCTTTGTCTGGTGGAGACAAGAAAGGTTTAAGGGAGGAGGTTACGGATGCCATTTGTGGACCATTCAGATA
GTTGAATACATGCATTTGGGATCCTACACAAAATCTATGATTAATTGATTGACAGCCGTGATTACAAGTACCGCAGCTTA
TGGACGAGTTGCAGCTTTTCGCTTCTAACCAATAAGAAGTTGTAGTGGAGGATTGCAGTAAAGCTTCTTATCTTGGAAAA
AACCATATCAAAATTTAGAAATGGAGGCACAGCTTCTACTTTAAGATCGCGTGTGGGCGGTCTGGTTGAAATTCCGATCA
TACTTGGCATGGCAGTCGTGTAAGTTGGCACGTGACGATAGTGACCTTTTGGATCTCCTAATGCGTACAGGCGGTGAGAA
CTTATGGATCCATCTCCAAGCATAGTGTGGCAGAAAAAGAAAATTTCCAGGTAGAAAAAAAAAGAGGACGGAGATTGCAG
AGTTACGAGAGGTGCCAGCCTACGACAAGCTGCCAACAGAACGCAGCTTTCATACTCAGACACCACCACTACGATGGGAC
GAAGCGCATTGAGAGCGGCATTGGCGGCCGAGAAGGGTGTGGATTTCAAGAAGTTGAGGGAAAAGAAGAGATACAAGCAG
GGTGTGAAGGAGAAGACAAAGAAGGGAGGAGCTGGCAGCGTGTCGAAGAAGGATGCGACAGACGAATGGGAGGACGAGGA
GGAGGAGGCGGAGGAGAGCGATGCCGGGGATGAGGACGAGGACCGGCTAGGAGTAAGTAGTTCTGTCTCTGCAGCTGGGC
AGATGAAACAGGCTATGGGATATGGGATACTGACCAACTCTTTTGCAGGCCGACTTTATTGCTGCCGTGGACGATTCGGA
CGAGTCAGACTCGGATGTCGAGATGGAGGCAAAGATTGTGCGGGTCAAGGCAGCCGCATCACCGACACCAGCAGCGACCC
GGAAAGAGAAGGCTGCCAAGGTGACTAAGGTGGCCAAGGCGACCAAGAAGGTTTCCAAAAAGGCCGAGGATGAGGATGAA
GAGGAAGAGGAGGAAGAGGATGGCGAAGAAGACGAAGAAGAGGACGACGATGCGGGCGAGGACGAGGAGGTCTCGTGGTC
GGACCTGGACGAGGAGGAGCGCGCGGGGCTGGCGGTCCAACGGCGACAGACGATCAACAACGCGGCAGCGCTGACGGCGG
CGCTGGTGCGGATCCGCGTGCCGACCGACAAGAGCGTGCCCTTTAGCACGCACCAGTCGGTGGTGCCGTTGTCGGAGCCG
ACGGCGGCCTCGATAGCCGACATCCAGGACGACGTCGCGCGCGAGCTGCAGCTGTACCGGCAGAGCCGCGATGCGGCCGT
GGCGGCACGCCGGCTGCTCCGTGTCGAGGGCGTGCCCTTTTCGCGGCCGGCCGACTACTTTGCCGAGATGGTCAAGGACG
ACGAGCACATGCAGCAGGTGCGGGCGCGTCTGGTCGAGGCTGCGTCCGCCCAGAAGGCCTCGGCCGAGGCCCGGCGCCAG
CGCGACCTCAAAAAGTTTGGCAAGCAGGTCCAGGTGGCCAAGATGCAGGAGCGCGCCAAGGCGAAGAAGGACACGCTCGA
GAAGATCAAGACGCTGAAGCGGAGTGAGTGTCCCGGTCGGTCCTCTGTCTCGATGGTCTGCTAACCGCGCTAACCCGCCA
GAACGGTCCGAGAATGGCGCGACCAACACCCACGAGGCCGACCTGTTTGACGTCGCCGTCGACACCGAGATCGGCGCCAA
GCGCGGCGCCTCGTCGGCCCCCGGCAGCCTCAAGCGTGGTCGCGACGGCGGCCGCAGCGGCGGCCCGCCACAGCCCAACG
CCAAACGCCAGAAGAAGAACGAAAAGTACGGCTTCGGCGGCAAGAAACGGCACGGCAAGTCCGGCGACGCCCAGTCGTCC
GGCGACCTCAGCGGCTTCAACGCTCGGCGCATGAAGAGCGGCGGCAGCGCCTTCAAGGCTCAGCGGCCGGGCAAGGCGCG
GCGACAGGCAGCAGGCGGACGGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62