GenePrediction:GLEAN_433 Details

Name: GLEAN_433
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1734893..1736914 (+ strand)
Length: 2022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1734893..1734936 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:1735204..1735244 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_167:1735327..1735424 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_167:1735480..1736188 (+ strand)
Length: 709
Type: CDS
Source: GLEAN
Position: GCSC_167:1736248..1736825 (+ strand)
Length: 578
Type: CDS
Source: GLEAN
Position: GCSC_167:1736891..1736914 (+ strand)
Length: 24
>GLEAN_433 class=GenePrediction position=GCSC_167:1734893..1736914 (+ strand)
ATGGGGGATACAGAGCCGAACTCCCCCACGTGGAAGTTCACACAGTACGTCATATGAAGCTCAGGCCGCGTTTTGATGCA
GCCCGCAATGGTGGTGGTGGTGGCTGCCAGATCCTGTTATAATATTGGTGCTGTGTTGTGCAGTTACTGTGCTGCTGGGT
CGCTGGGTCGCTGGCCATTTTGGTTCTGCAAAGCTTCTTCCAGCTCTTTCCCAGATCACCGGATCTCCACCACCCTGCTC
CATCCTAGATTGTCTTGGCACCAAGCATGCTTCTTTTTGCCACCCAATGGCTGTGGCTAACAATACCACAGATGCTTTGG
TGATAAGGGAGACGTGGAGGATATCACAGAAGGTAAAGCGTGATGCTGCTTCCCAAATCTGGGGGTGGGACAAGATGGTA
GGCTGGAACAGGGTCGGCTAACACATTCTCGCAGCGGATATCATCTCCACCGTTGAGTTTGACCACACCGGAAACTACCT
CGCAACGGGCGACAAGGGTGGGCGCGTTGTCCTGTTCGAGAGGAACGAAACAGTGAGTACAGCCCTAGAACGCTGCACCA
TAGTGTAGGCGTCCTGTTAGAGAGCAGGACGGAGAGCGAGCGGCTGCTGATATAGGGCCGGCGGCGTCCCCCCCCCTCGT
GCAGAAGAAAACGTGTGAATACAAATTCCACACCGAGTTCCAGTCCCACGAACCCGAGTTCGACTACCTCAAGTCCCTGG
AGATCGAGGAGAAGATCAACAAGATAAAGTGGTGTCGGCGGCAAAATGCGTCACACTATCTGCTTTCCACAAACGACAAG
ACCATCAAGCTATGGAAGGTGTTTGAGAAGTCGCTCAAGGTTGTGGCCGAGAACAACCTGTCCCACGACCTGACACCCGG
CGGCCTTGCCGTCGGTGGCGGGGCACCACGGCCGTTGCCCAGCGTGCACTTCAGAAATGCAAGCGACCTCAAGCTGCCAC
GCTTGACGCACCACGACACCGTCGTTGCGGCCGTCCCCCGCCGGACGTACGCGAACGCCCACGCATACCACATCAACAGC
ATCTCAGTCAACAGCGACGGCGAGACCTTTATCAGCAGCGACGACCTCCGCATAAACCTGTGGAACCTAAACATTCAGGA
CCAGAGCTTCAACATTGTGGATATCAAGCCAGCGAATATGGAGGAGCTGACCGAGGTCATCACTGCTGCCGAGTTTCACC
CCCTCAGCTGCAACTGGTTCATGTATGCCAGCTCGAAAGGCACCATCAAGCTGGCCGACATGCGGGAGAGTGCGCTCTGT
GATCAGCATGCCAAATGTGCGTCACCTAGCCTTTCACGTGCGCCTGCGAGTGCGATGCTAACCTGTCCCAAATAGTATTT
GAGCAAGAGGAAGATCCACAATCCCGCTCGTTCTTCTCCGAAATCATCTCCTCCATCTCCGACGTTCGCTTCTCCTACGA
CGGCCGCTACATCCTGTCCCGCGATTACCTGACGGTTAAAATCTGGGACGTGAACATGGAGCGGCAGCCGGTCAAGACCA
TTCCCATCCACGAGCACCTGCGGCCACGGCTATGCGACACATACGAGAACGACAGCATATTCGACAAGTTTGAGGTTGTC
TTTTCAGGCGATGCCAAGAACGTCATGACGGGGAGCTATAATAATAATTTCATGATCTATCCGACCGACCCCGACAAGGA
GATGGAGGTTGTATTGCAGGCGGACAAGTCTGCTTTCAAGGCCAAGAAGGTCGGCGTGCCCACGCCGATCAACTCGTCGA
CGAGCCCGTCGGCAAATGGAAAGAAGGACAGCTCCAGAGCGGGAAGCCCTGCGGGACAAGGCCAACGGATGCGGAAGGAG
ACGGATGCGGACCAGATCGACTTCAACAAAAAGATCTTGCATATGAGTTGGCATCCATTCGAAGACAGCATTGCCATTGC
CGCGACGAACAATGTGAGTACCCCAAACCCGGGTGTTTGCGCCATTCACGACATCGATATTGACTAACCTCTGTACAGCT
GTTTGTCTTCTCTGCTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62