GenePrediction:GLEAN_4342 Details

Name: GLEAN_4342
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:532423..531238 (- strand)
Length: 1186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:532423..532176 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_179:532110..531426 (- strand)
Length: 685
Type: CDS
Source: GLEAN
Position: GCSC_179:531363..531238 (- strand)
Length: 126
>GLEAN_4342 class=GenePrediction position=GCSC_179:532423..531238 (- strand)
ATGACAAGCATACGTGGGCTTGTCCGCACAACGCGCCCTGCGCGGCCGTCCCGCATAGTAGCGCGGCCACAGGCGGCGCC
GTGTCTGTTCCGATGCGCCTCGAACCAGGCGGCATTGCCAGCCGAGCCGGCCTTTGCCGATCTCGAGAAGGATTCGTCCT
TTCTGACGCCACAGCTGCCGGCGGACGTCAAGATCCCGAGCCCGCGGGATCGTGCGCTGCAGCGAAAGTCCCGGCTGCCG
GGCGGACGGTGCGTCGAGCGAAACGAAAAAGAATGAGGGCGCTGCTGACCCCCGACGTTTTTGTTGCTTCTAGATACCAG
TTCCACCCGCCCAAGTACGACCGTGGCCCGCTGCATCCGGTGCAAGCGCCGCCGTCGTCCGACCCGGTGGCGCGCGACTT
CCAGCCGGGGCCGTTCAACTTGCCGCGGCTGAAGGAGACGTTCCACTCGACGGTGGCGGCCGATCTGATGACGCTGGCCT
ACACGCACACACCGCCGGGCACGGGCAAGGAGCCGACGCCGGACCGGCTGCGCGCTTGGGATGGATCGTCGCCGTACCAC
AAGAACCGGTCCCGGCGAGCCCCCCGCGGCGAGCCGGTGCTGCGGCCGCTCGAGCGGCCGATCTCGTTCAACAACATCCC
CACGGTGCGATCGGTCACGCTCGCGGCCTTTGTCCCGCTGGCCGTCAAGGAGAAGGACCGGCTTGTGGTGGCCCGCTCGG
TCATCCAGTCCATCACCGGCGTCGTGCCCGAGGTCACCACGGTCAAGCACAACGTCGCTCAATGGGGCATCATCAAGGGC
CAGCAGGCCGGCCTCAAGGTCACCGTGCACGGCAATGCTGCCTACGAGTTCCTCGACAAGTGCATCCACCTCGTCTTCCC
CCGCATCAAGGACTGGAAGGGCATCAAGGGTAGCACCGGCGACAGCGTCGGCAACCTGGCCTGGGGCTTCCGCCCCGAAG
ACGTCGCGCTCTTCCCCGAGATCGAGGTCAACTACTCGGTGCGTTTTTTTCTCGTGTTCTTAGTGTCCTCTGTCCTTCCT
ACCCTCGCTAACCTCGCTAGATGTACCCCGGGAAAATGCTGCCTGGCTTCCGCGTCTTCGTCGAGACGTCGGCCAAGTCT
GACAGACATGCCCGGCTGCTGTTGCAGGCCTTTGGCATCCCCTTCTACGGCGAGATGCGGGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62