GenePrediction:GLEAN_4343 Details

Name: GLEAN_4343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:528238..526445 (- strand)
Length: 1794
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:528238..528232 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_179:527962..527932 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_179:527809..527754 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_179:527668..527638 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_179:527532..526761 (- strand)
Length: 772
Type: CDS
Source: GLEAN
Position: GCSC_179:526675..526445 (- strand)
Length: 231
>GLEAN_4343 class=GenePrediction position=GCSC_179:528238..526445 (- strand)
ATGGAAGGTAAGTCTGCTATCTCCTGCCCAGTATCTTCCACCTGGCATCTTCGGCCTCTCCGAAGCTCGCGGTCTCGCGG
AACGTTCGCGGCTGGCGAATACCGGTCACGGCGATGCCAACGGCGAACGATCCCGAGCTTCAGCACATCTCCCTTTCCAT
CTATCCGCCATCACTGTCTATCTGTCCACCGCCTCACTGCTTTGACGTCTCACGTCTGGCTCACTTGCCCGGCGAGATGA
GCTGAGGACAGATCACATGCTAACAACGCATTAAAGAAGAGGTTGCCGCCCTCGTTATCGACAATGGGTAAGCCATCTCG
ACCCTCATCGGTTACTTCCGTCCGCTATCGACGCGAAATATCCCGCGTGGTCAAGGCGTTGGACGCGGCTGTCCGAGCCG
GGAGTACATGCTAATCTGTCCTCTTATAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGACGCTCCTCGTGCTGT
CTTCCGTAAGTTTCACCTCCTCAATCTTTTGGGCTGTTGAGCTTGCCATTCGGAGCTCACCGGAGAGCACACGAGCTAAC
CACCGCATAGCGTCCATTGTTGGTCGGCCCCGTCATCATGGGTCAGTATACGCCGCCTCCTTTCGTTCAATTCCGACCCT
CCCCCTATCCAAAAGAATATGAACGTATCCCAGCTATGGAAATTTCGCCTAACATTGTGGCTATAGCATCATGATCGGTA
TGGGCCAGAAGGACTCGTACGTCGGTGACGAGGCACAGTCCAAGCGTGGTATCCTCACGCTTCGGTACCCCATTGAGCAC
GGTGTTGTCACCAACTGGGACGACATGGAGAAGATTTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGA
GCACCCCATCCTGCTCACGGAGGCTCCCATCAATCCCAAGTCCAACCGTGAGAAGATGACGCAGATTGTGTTCGAAACCT
TCAACGCACCGGCCTTCTACGTCAACATCCAGGCCGTGCTGTCCCTGTACGCATCTGGTCGTACCACTGGTATCGTTTTG
GACTCTGGTGATGGTGTCACTCACGTCGTGCCCATTTACGAAGGTTTCGCTCTGCCGCACGCCATTGCACGTGTCGACAT
GGCTGGCCGTGATTTGACCGACTACCTGATGAAGATCCTGGCCGAGCGCGGTTACTCCTTCTCCACCACTGCCGAGCGCG
AAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTGGACTTTGAGCAGGAGATCCAGACGGCTGCCCAGAGC
TCCAGCCTGGAGAAGTCATACGAGCTTCCGGACGGTCAGGTCATCACTATCGGCAACGAGCGGTTCCGCGCCCCCGAGGC
TCTGTTCCAGCCGTCCGTGCTGGGCCTGGAGAACGGCGGTATCCACGTGACCACCTTCAACTCGATCATGAAGTGCGATG
TCGATGTCCGGAAGGACCTGTACGGCAACATTGTCATGGTAAGTGGCGACAGGCAAGGTGGCGAAACGGGTGACACGCAC
AACGGAACTTTCGCTGACACTGTCTTTTTTCCCCCATCTCTAGTCTGGTGGCACCACCATGTACCCCGGCCTGTCGGACC
GTATGCAGAAGGAGATCACCGCCCTGGCCCCGTCGTCGATGAAGGTCAAGATCATTGCTCCCCCCGAGCGGAAGTACTCC
GTCTGGATCGGTGGCTCTATTCTTGCGTCTCTGTCGACGTTCCAGCAGATGTGGATCTCGAAGCAGGAGTACGACGAGAG
CGGTCCTTCGATCGTTCACCGCAAGTGCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62