GenePrediction:GLEAN_4347 Details

Name: GLEAN_4347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:492107..490370 (- strand)
Length: 1738
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:492107..492062 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_179:491952..491780 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_179:491641..491558 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_179:491408..491060 (- strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_179:490973..490575 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_179:490503..490370 (- strand)
Length: 134
>GLEAN_4347 class=GenePrediction position=GCSC_179:492107..490370 (- strand)
ATGGCGCAAACCCGGCCAACGGCGTTCAGCAACATGCGGATGGGGGGTAAGTGAAGCCAAAGTTGATTGACGGAACGATC
TCCAATTTCCGCTTTCCTTCCGTCATATCCCTCATTCGTCTCGGCTACTAACTCTTCTGCTTCTCGCCCGTACAGAGGTC
GTCCACGAAAAGGTTCAGGATGGAGTGACCGGAGAAACAAGGGATTTGCAATACACCCAATGCAAGATTGTAGGCAATGG
TTCCTTTGGCGTCGTCTTTCAGACGAAATTGTCGCCTTCCAACGAGGATGCTGCCATTAAGCGCGTCCTCCAAGACAAGA
GATTCAAGGTACGTTATCGATGGTTCCAGTGGTCAATACAAGTTTCCTTCCGCTCAATCTCTCATACACCGGTTCTTAAT
GAATTGTCTTTTGGTTTGGAAGCGTGTCGGCCCTTTCATGAAGAACTTCGCGACTAACTTTTTTAGAACCGTGAGCTGCA
AATTATGAGGATTGTACGGCACCCAAACATCGTGCAACTAAAGGCCTTTTACTACTCAAACGGCGAACGTGTGAGTCGTC
CCTGCTTGCATTGCATTGCCTCGCTTCGCTCGTATAGCCCGCAGCCACGGAAGACCCGTTACATCAGGGCAATTGGCCCC
ATTACGATACGTTATTCTCGTCTTGTCGGACTGATCACTGACAAGATCCTTTTTCACAGAAAGACGAAGTCTACCTTAAC
CTGGTGCAGGAATTTGTGCCAGAAACTGTGTACCGAGCCTCTCGTTTTTTCAACAAGATGAAGACGACCATGCCCTTGCT
GGAAGTAAAGCTCTACATCTACCAGCTATTTCGCGCCCTAGCCTATATCCATTCGCAAGGCATCTGCCACCGTGACATCA
AGCCACAAAACCTCCTTCTTGACCCGACTACGGGCATTCTTAAGCTGTGCGATTTTGGCAGCGCCAAGATACTCGTCGAG
AACGAGCCCAATGTGTCGTACATCTGCTCCCGGTATTACCGGGCACCTGAGCTGATATTCGGTGCAACAAATTACACCAC
GAAAATCGGTATGTTCTGTTACTACATCCGGTGGGATGCAGGCCATCCTTGCATCACCTTGTATACATGTATGCTGACGC
ATAGTCGTTGGTAGACGTCTGGTCGACCGGTTGTGTTATGGCAGAACTTATGCTGGGACAGCCCCTGTTTCCTGGAGAAT
CCGGCATTGACCAATTGGTTGAGATCATCAAGATTCTGGGAACACCTACGCGCGAGCAGATCCGGACCATGAACCCGAAC
TATATGGAGCACAAGTTCCCCCAGATCAAACCGCATCCTTTCAACAAGGTGTTCCGGAAGGCCGACGCCAATGCGCTTGA
CCTGATTGCTCGCCTTCTTGAATACACGCCGACGGAGCGCCTCGCTGCTGTCGATGCCATGGTCCACCCGTTCTTCGACG
AACTTCGTGACCCGAACACGAAGCTGCCCGACTCCAGACACCAGACAGGCACCCTCCGCGACCTGCCGCCTCTATTCAAC
TTCTCTCGCCACGGTAAGAACGCTGACAATAGGTTCTTTCAATTGGACATATTGACAGCCGCTAACTTTCTACTACTTAT
TTAGAGTTATCTATCGCACCAAATCTCAACCAGAAGCTGGTCCCCCCACACATGCGACCTGTTCTGCAGGCGCAAGGACT
AGATATCGACAACTTTAAGCCCATGGCGAAGCAGGAGATGATTGCTAAGCTCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62