GenePrediction:GLEAN_4348 Details

Name: GLEAN_4348
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:488761..485832 (- strand)
Length: 2930
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:488761..488683 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_179:488612..486927 (- strand)
Length: 1686
Type: CDS
Source: GLEAN
Position: GCSC_179:486865..486243 (- strand)
Length: 623
Type: CDS
Source: GLEAN
Position: GCSC_179:486050..485832 (- strand)
Length: 219
>GLEAN_4348 class=GenePrediction position=GCSC_179:488761..485832 (- strand)
ATGGCCGACTATGAGCGCAGAGGAGGAGGTGGCGGTGGCGGCGGGTATCACAACAGCTACCGCAAGCGCCGTTTCAGAGG
TAGGTGAGCAGGACGAGATGGGCAGGATTGAGGTTTGGATGCTGACGTTGTTGTCCCTGATGTGAGCAGACGACGACAAC
GACTACCGAAATCAACGTCGGCGACAGGACGTGCCGGCGCCACTGCGGATCCGGCGACAGCTGCTCACGCTGGCGGAGTC
GCCGCTGCGGCGGTGGCACGACGACGCGGTGACGGTGGCGCGACTGGTTGCGGACAACGACGACGACGCGCACGTGCGGG
AGGGCTTTGTGCAGCTGGCGTGCCAGCTGGTGCGGGAGCAGCCGCTGAAGACGCCATTTGTGGCGGCGGTGCTGCTGGTG
GTCAACACGCTGAAGCCGGCGATCGTGCTGGAGGTACTGCGGCACGTGGCGGGCGCGACGGAGGAGGCGATCGCGGCCGG
ACAATGGCGCGAGGTGAAGCTGCACCTGCGGCTGCTGGCATGTCTGCAGACGTGTCTGCAGGGGGACGGAGTGTTCCCGC
TGTTGGACATGCTGTTTGAACGGGCAGTGGATCTACAGACGGCCAGCTCGGACGACGTGATCGGCACGGAGCTGGTCAAG
ATTATCTTGTTGACGATCCCGTACATCATGGCGGCGGCACCGGGTCAGGAGTGGCAGCAGCAGGCGGCAGACCTGATGGA
GAAGACGGACGTGATTGCGTCGGAGCCGCACGCGCTGCAGAAGCTGATGGATCCGTATCTGCACGGGCGGCTGATTGCCA
AGTCAGGACGGGCGACAACGGGGACGACGAGCAAGAGCGGCAATGGGGACGTGGCGATGGGCGGGGATGAGGCAGCGGTC
GACGACAACGACGAGGACGAAGAGGACGAGGACGCGCCGCCGCCGGCCGAGAGCCTGTTGGCGCTGCTGCAGAAGCAGCT
GCAGGCGGAGGCGGCGAGCGGGTGGCCGCTGGCATGTCTGCCGCGGCCGTGGAAGCTACCGCTGGAGGACGTGGAGCTGC
AGTCGAAGCTGGACGAGTCGGAGAAGCACACGCTGCCGGAGATTGCGGTGCCGGCGACGGTGGTGGCAGGGCCGCGGCCG
CTGTTTCCGGAGGTGTACTTTTCGGTATATGGAGCCGGGGCAGCAGGAGCAGGTGCAAGCGGGCTGCCGCAGTCGGTGCC
GGCGGTGACGAGTGTGGCGGCATCGCTGATCCGCGACAGCGTTCTGGACACGATCAACGTGATGCACTTCAACCGCAACG
TGACGGCGCGGTTTTTGATCGACGTGGACTGCTACTTTGCAGACGAGACGTTTGTCAAGCGGGCGACGCCGTTTGACCGG
CTGCGCGAGCTGGAGACGGCGACGACGTGGAAGCCTGAGGACGTGGCAGTGGACGCGGTGTTCTCACAGCTGCTGCAGCT
GCCGATGCCGGAGCACAAGCTGGTCTACTACCACGCAGTGTTGGCGGAGGCGTGCAAGATTGCGCCGGCGGCGATCGCGC
CGAGTCTCGGGCGGGCGATCCGGTATCTGTACCGGCACAGTCACCGAATGGACCTCGAGCTGGTCGGCCGGTTCGTCGAC
TGGTTCTCGCACCATCTGAGCAACTTTGGCTTCACGTGGAAGTGGGCCGAATGGGTGGACGATGTGGCGCTGCCAGACAT
CCATCCGCACAAGGCGTTCATTCTCGGGGCGATCGACAAGGAGATTCGGCTGAGCTTTGCGCAGCGGATCAAAAACACGC
TGCCGGAACCGTATAAGGAGCTGATCAAGCCGGAGACGGAGAAGGATGTGCCCGCATTCAAGTTTCAGACCGATGGTGTG
TTCTTTTCGATATTTTCTCGGTTTTCTTTTTCTCTCTTTACTCTGCTAACCGACAGACACCCCCTTTGCTGCCGAGGGCC
GCGAGCTGGCTGCTCTGCTGAAGCGCAAGGCTCCGGACGAGGAGGTACAGACGGTGATTGGGCGGATCCAAGACCTGGCG
CTGGACAGTGGACGGGACGAGCCACTGGTGGCATCGATGGACGTGTTCACGACAGCGGTGCTCTGGGTGGGCTCCAAGTC
GCTGTCGCACGTGCTCGCGTGCATTGAGCGGACCAAGGATCGGTTCCTGGACGCGGGAGCAGCATCGGAGGCTGCGCGCA
GCCAGATCCTCGAGGCGGTGATGACGTTTTGGGCGGCGCACCCGGGCATTGCGGTGTCGATCACGGAGAAGCTGCTCAAC
TATGCGATCCTGTCGCCGGAGACGGTGGTGAAGTGGGCGCTAGACAAGAAGGAGGAAGAGGCTGACAAGGCCGAGACGGC
CGAGACGGCACCTCGACTTTCGCAGGCCTTTGTGGCCGAGCTGGTCTTCAACACGGTCGCCAAGGTGACGCGACGGATGC
GTCAGGTGGTGGTGACGTCGCAAGCAGCCAGCGCGACCGTGGTGGCGGCATATGCAGCCGTGGATGCAGCCCGGGAGCAG
CAGCAGAACCCGGGATCGCTTGCAGTGGCTGCAGTTAGTGTGGGTGGCAAGACGACCGACGGCATGGACGTGGACGACGG
CAGCACCAACGACGACGGGACGACAGCAGCAGCAGCAGCAGCGGCTGAGGCAGCGTTGCGGGTGGAGACGGCCGAGGCGG
CGCTCGTGACGGCCACGGCCGAGGCAGCAGCTGCTCGAACTGCTGAGACGGCCGACATGCGTGCGATGCAGAAGCTGTTC
CAGCGGGTGGCCGAGGCCGTGGAGCCGTGGGCGGCGGCATCGTCGCCGCTGGTCGTGCGCGCCTGGGCTGAGCGCTGGCA
GCGCGTGGTGCGGCGTCGTCAGGCCATCGAGGAAGCCTTTCTGGCTGAGGCGGCCAAGGCTCGGATGGCGGCTGAGGTGG
CCGAGACCGAAGCCGAAGCCGCGGCCAACAGCAGCAGCAACAAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62