GenePrediction:GLEAN_434 Details

Name: GLEAN_434
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1738541..1739871 (+ strand)
Length: 1331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1738541..1738838 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_167:1738913..1739871 (+ strand)
Length: 959
>GLEAN_434 class=GenePrediction position=GCSC_167:1738541..1739871 (+ strand)
ATGACCTCCAATTCCTACCCTCGCCGCCGCCAGACTCCGCACAAACCCCCCAAACATGCGGCCCCGCCTCCGGGCCCTCG
AGTGATCAACGCCGCCCCTTCTCTGGAAAAGGCTGAGATGTATGGGGTTGACGATGATCGGCCCGTGTTTTCGCGGGCCA
TGGCTCTGGCTGGCCGCATCTTCATCGAGACCATCCCGCAATGGATCTCGGTCGGCGCCATGCTAGCCCTCATCTTTGGC
GGCTGCTGTTCGAATGTGTTTGCGCTCGAGGCCATTATCAAGGTTGAGCCTGGAAGTGGTGGGTTACCGTCCTTCCCTGT
CATACCGTCTGCCTGCCACCGCATTGGCTGCTCTCCTGCTGATATGCCACAGGCACGCTCCTGACGTTTGTCCAGTTTCT
GTTTGTGGCCATCACCGGCTACATCTCGCAGCTGGACCGCGACCACCCCCCCTTCTTCTTGCGTCCGAACAAAGTGCCGC
TCCGTCGATGGCTGGTCAACATAGTACTCTTTTTCAGCATCAACATCCTGAACAACCACGCGTTTAGCTACAACATCTCC
GTCCCCGTCCATATCATCCTGCGCTCTGGCGGAAGCATCACTACAATCCTTGCCGGCTTTCTCTACGGAAAGAGGTATTC
GCGTATCCAGGTCGTCGCTGTCCTTCTGCTGACAATTGGCGTCGTGATGGCTGCCTGGTCGGATGCGCCGGACAAGAGCA
ATGCTACCGAAGACAGCGACGAGGCTACGGACCACGGGGTTCGTTTTCTCAGCGGCCTGGCCATCCTGTTCGTGGCTCAG
GTGCTGTCGGCCATCATGGGGCTTTACACGGAGGAGACGTACCGCAAGTACGGTCCCCAGTGGCGGGAGAACCTGTTCTA
TTCCCATCTGCTATCGATGCCACTTTTCCTCCCGTTTCTGCCGTCGCTCGTGCGCCAGTTCGCACGCCTCGCCAGCAGTC
CACCGCTGACATTACCGTGGGGCGAGACGCTGGATGCGGCACCTGTGGCGGCAGGGATCCGCAAAAACGTCGAGCGCATT
CAGATCCCGAGCCAGCTGGTGTTTCTCATGATGAACGTCCTGACCCAGTACGCCTGTATCCGCGGCGTCAACCTGTTGGC
GGCGGCGTCGTCGGCGCTGACCGTGACGATTGTGCTGAACATCCGCAAGCTCGTCAGCCTGCTGCTGAGCATCTGGCTGT
TTGGGAACCGTCTCGCACCGGGCACGCTCGCGGGAGCGGCGGTGGTATTTTTCGCCGGCGGGCTGTACTCGCTGGACGGT
CGCAGGAAACCGGTATCGCGCACAAGGGCGGCCAGTGTCAAAGGCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62