GenePrediction:GLEAN_4350 Details

Name: GLEAN_4350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:481986..478192 (- strand)
Length: 3795
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:481986..481816 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_179:481712..481630 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_179:481527..478485 (- strand)
Length: 3043
Type: CDS
Source: GLEAN
Position: GCSC_179:478428..478192 (- strand)
Length: 237
>GLEAN_4350 class=GenePrediction position=GCSC_179:481986..478192 (- strand)
ATGACCCGACTCGACAGGAGATGCGACGGTGCCAATGAAAGTGAAACGGAGGCTAACGTCGACGACCGCAGACACGACGA
GAGCCCTGTATCGGTCCTGTGTCCGGGGTGCTGGCACACGGCTCGCTCAAGCGGTTGTCCGTGGCTGCTGTGCTGCAGGC
ACGATAACGAGGTATGTAAGCAGGTGTGGATGGACGCAGGATGTGCTGCGGCTGTCTCGCCGGTGCTCTATTCGACGGTG
GCGGTCAGGCCGGCATGGCATTGTCTGGCCACAGGTGGCCAGCGGCCAGCGACCAACGGCCAGCGACCAGCGGCCAGCGA
CCAGCGGCCAGGCCCTCCCAGGCTTCCAGCTGCACACGTCAGATGAGGTGGCGGTACCGGAAACTGGCCTGCGTCATAAA
TGAGCCGTCCTCGCGCTTCCCCACCCGCTTTTGATGGTTTTGTTGTTGACCAGCGCCAGACCGCAAGTCCGTTTCGTGGC
GACCCTGTCTCAGACAGCATCCGATCCCAAGAGCAAGATGGCGCCTGCCAGCCATTTCCGCGAAATCCAGAGCTTCGAGA
CGAGCTATGCACCTACCAAGATCACCCAGTATGTCTCGCAGCGCAGCGGGATGCACGTCGTCGTGGCCAACCGCAAGGGG
CCCAAGATCAACGGCTACTTCACCCTGGCCACCGAGATCTTTGACGACTCGGGCGCGCCGCACACGCTGGAGCACCTCGT
CTTCATGGGCTCGCGCAGCTACCAGTACAAGGGCCTGCTGGACAAGCTGGCCTCGCGGGCCTACTCGGGCACCAACGCCT
GGACGGCCGTCGACCACACCGCCTACACGCTCGAGACGGCCGGCTGGGATGGCTTCGCCCAGATCCTGCCCGTGTACCTG
GAGCACCTGATCCTGCCGACCATCACGGATGACGCCTGCATCACCGAGGTTCACCACATCAACGGCAAGGGCAACGATGC
CGGTGTGGTCTACTCGGAGATGCAGGGGCTGCAGTCGAGCAGCGCCGAGCTGATGGACATCCGCGCCCGCCGCCTGCTCT
ACCCCGAGACCGTCGGGTTCCGCTACGAGACCGGCGGCATGGTCGAGGCGCTGCGCGTTCTCACGGCGGACCGCATCCGT
CAGTTCCACAAGGCCATGTACCAGCCGCGCAATCTGGCCGTCATCGTTGTCGGCGAGGTCGACCAGGCGGCCCTGATCAG
CATCCTGGATCGGTTCGAGGACAGCATCCAGGACAGCATCCCGCCGCTGGACTCGCCCTTCCAACGGCCGTGGATCGACT
CGGCGCAGCCGCCGGCGCTCGAGAAGACGGTCGTCGACACGGTCGAGTTCCCGGAGGACGACGAGTCCATGGGCGAGGTC
ATGGTCGGCTACTTTGGACCCAACTGCAACGACGTGGTGGCGACATCGGCGCTAAACGTGCTGCTGGCATACCTCTGCGG
CTCGTCCGCGTCGGTGCTGGAGAACGTGATTGTGGAGAAGGAGGAGCTGGCCAGCTCGATCAGCTATTTGTGGGAGTCGC
GGCCGAACTGCCTGATCTGGTTCCAGCCAACGGGCGTGGCGACGGAGAAGCTCGAGTTTGTGGAGCAGCGCCTGATCTCG
CTGCTCAAGGAGGTGGCCGACAAGCCGCTCGACGTGCCGTACCTGCGCGAGTGCATCAGCCGGGAGAGGCGACAGGTCAA
CTCGCAGGCCGAGAGCTCCGAGAGCTTCTACTCGACCAACATCATCACGGACTTTCTCTTTGGCGAGCGCGACGGCTCGA
CGCTGGCCGACCTGAAGGACTTGCGCGAGTACGACGTGCTCGAGAGCTGGAGCGAGGAGCAGTGGCGGGCGTTCCTGAAG
AAGTGGATCGCAGACGCCCACCACGTGTCGATCTTGGGCAAGCCGTCCAAGGCGCTGGCGAAGAAGCTCAAGACAGCCGA
GAAGGAGCGGCTGGCGAAGAGACGCAAGGAGCTGGGTCCTGAGGGCCTGAAGAAGCTGGAGGAACGGTTGGACGAGGCAA
AGAAGAACAATGACATGCCGATCCCAGAAGCGGTGATCGACAAGTGGGAGGTGCCAGGGACGGAGTCGATTCACTTCATC
GAGTCGCAGACAGCACGCGCCGGCAAGGCGAGAAGCCTCGGCGTGCTGGACAACGCGGCACAGAAGACGATCGACGCGGC
GGTGCCAGGCAAGACGCCACTGTTCCTGCAGTTCGAGGACGTGCCATCCAACTTTGTGCGGATCGTGGTGCACGTCAGCG
CGGCCGGAGTGCCGACACGGCTGAAGCCGCTGCTCTCGCTGCTCAGCGACCAGTTCTTCAACAGCCCGGTGATGCGGGAC
GGGCAGCGAATCGAGTTTGAGGACGTGGTCAAGGAGCTGGAAAAGGACACGATCAGCTACGTGTTCAAATCGGGCGGGGG
GCTGGGCGACGCCGAGAGCATTGTGCTGCAATTCCAGGTGGAGCCGCACAAGTACACCGCGATCATCCGGTGGCTGCGGA
CGCTGATGTTCGACTCCGTCTTTGATCCACAGCGACTGAGGGCAGGCGTGGCCAAGGCGCTGGCAGACATCCCAGAGAAC
AAGCGGTCCGGTCGGCTGATGGCGTCGGAGGTAGAGCTGGCGATCCACACGGTGGCAGACTCGTGTCCGGCAGCGAAGCG
GACGCTGGTGCGGGCAGTGTACCTGCGCCGGATCAAGAAGCTGCTACAGACGGAGCCGGAGACGGTAGTGGGCTGGTTTG
AGGAGCTGCGACGGGCGCTGTTTGCGTTCCGGAACATGCGGGTGCTCGTGACGGCAGACGTGGGCAAGCTGGAGGCGGGA
GCATCGGCGCCGGCCGTGGCCGCCTGGGATGTGCTGACAGACGGGATGGAGGTTTTGGCGGACGAGATGGTGCCGATCGT
GGCACCGTACTCGCGAGCGAGCGCGGAGGGCCGACAGCCGGGCGGCGTGGGGGCCTTGATCCTGCCGATGACGACGCTGG
ACTCATCGTACAGCATCTCGACGACGACGGGACTGCGGTCGTTTGCGGACGCGCGACTGCCGGCCGTCCTGGTGGCTCTG
GGCTACCTGGAAGCAGTAGAGGGGCCGCTCTGGAACGCGGTGCGCGGCAACGGGCTGGCCTACGGCACGAGCTTCAGCCG
GGAAGTCGACGGCGGGTATCTGCAGTTCCGCGTGTACCGGTCGCCGGACGCGAGCAAGGCGGTGGCGGCAGCACGCGATG
CCGTCGAGGCGCTGGCTGACGGCCGCCAGCCGCTGGACAAGCACCTGGTGCAGGGAGCCGTCAGCGGCATCGTCATGGGC
CTCGCGGACGAGCAGGCGACCATGGGCCTGGCCGCTCAGCAAAACTACGTGACGGGCGTCGTGCGCGGCCTGGACGCCGG
CTGGAGCGCCCGGGTCATGCGGGCGGCTGCCCGCGACGTCACCCACGACATGATCCGCGAGGTGCTGCGCGATCTCGTCC
TGCCTGTCTTCCGGCCGGGCTCCAGCAATGTGGTGGTGACGTGTGCGCCCTTGTTGCAAGAGGTGAGTGGGAGTGGTGTG
CGTGGAGATGTGTCTTTGGGTGGAAGCTGACCGAACAGCCTATTCAAAACGCGTTCAAGGACATGGGCTACAAGACCGAG
GTCAAGAAGCTGTCGGACTTTTACGACGACTACGGCTTGGCCGGCGACGACGACGACAAGGAGGACGAGGATGAGGACGA
TGAGGAAGACGAGGAAGAAGATGAGGACGGTGAGGAAGACGACGACGATGACGACGACGACGACGACGACGACGACGACA
GCGACGACGTGGACATGACCGACGAAGATCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62