GenePrediction:GLEAN_4351 Details

Name: GLEAN_4351
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:470273..465471 (- strand)
Length: 4803
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:470273..469982 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_179:469861..469590 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_179:469519..469371 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_179:469316..469073 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_179:468999..468385 (- strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_179:466810..465883 (- strand)
Length: 928
Type: CDS
Source: GLEAN
Position: GCSC_179:465784..465471 (- strand)
Length: 314
>GLEAN_4351 class=GenePrediction position=GCSC_179:470273..465471 (- strand)
ATGTCCACGGCCGGTTCGCACACCCGCTCGGCAACAAACGGCGTCATGGCCCACACCCACGATGTGTCCGCCATGACAAA
TGGCCACGCCCACGACACCCGCCCTGCGCCGCCTCCGCCACCACCCCCGCCGGGCTCGTCCGCCGCACCGGCAGCCCCGG
CTCTATCCAAGATGAAGCAGAACAAGAGGCAGCAGAACGTCGCCTCCAACGAGGCGTCCAAGCTAGTCGCCCAGAAGATT
GCGCAGCTGGAGCTGGACCAGGCTGGCGAAAAGGACCAGGAGCTGGAGATTGGTGCGTGACCTGAGGACACTCTTTCGCG
CTTTTGTCCTTCTTGCTTTTGTCTTTTGCCTTTGCTCTTTCCCCCCTCTTTGCCTTGAAGGTGTCTTTTGGCTCACAAGA
CGCATGTTCTAGAAAAGGAAGTGCGAAAGGCAAATCGCGAACTGCACAGTCAGACGGCAAAGATGGACTCCTTGCAGAAG
ATCGACCATCTGTCGAAGCGCTGCACAGATCTGTTGCACGAGATGAAGCGGCTCGAGCGCGAGAGCCAGAAGAACAAGAA
GAAGAACGACCAGCTTCAGAAGGAGCGGGACCAGAGCCGGAGCGACCTGAGCAAGACCATCGGCCTGAAGGAGAAGTTGG
AGAAGCTCTGCCGCGAGTTGCAAAAGGAAAACAACAAACTCAAGGTTCGATCTGCACGCCCTGTACTCTGTACTCTTGCA
ACCGGCACGCTGACAGGTTACTTATTCGGAATAGAACGAGAACCGGACCATGAAGGCCAACGAGGTCTCTAATCTGAACT
CTTGGGACCAGAAATATGCAACGCTGCTGCAGAAGCTCGACGATCTGCAAGACGAGAAAGACCACCCCAAAAAGCAGGTG
GTGGATGTCGAGCTGGACGAGTTGTACGTGTCTTTCCCTCCCCGGTAGTCCTGCGCTTGCTGACCGTATCGGCTCAGGTT
TCGGCAGCGATTCAAGTCGCTCATCGAGCAGTACGAGCTGCGCGAACTTCACTTCCACTCGCTCATGCGCACAAAGGAGC
TGGAGGTGCAGTATAACATGGCGCGCTTTGAGCGCGAGAAGAAGCGGGCCGAGGCCGAGGTGGCTCTGTCACGGCGGCTG
AACGAGCAGGTGCAGACCTTTTCGCGGACAGAGAGTGAGCTGCGGAATCAGCTCAATCTTTACGTGGAGAAGTTCAAGCA
GGTAAGCCTTCTTCCATGAGCCGGCTGGTCTTCTGGCCATTGTGGCTGCTCTGCGCCAACCATTGACAGATCAGAAGGAG
ATGGAGGAGGCGTCCAGCAAGACGAGGAAGCTTGAGAAGGACAACGACGGCATGAAGAGAAAGCACGAGGCGATGAGCCA
GAACGTGGTGAAGATGGCGGAGGAGCGGGCGGAAAACGCACGGCTCCTGGACCTCACAAAGAGGCAGCTGGAGAAGCTCA
AGTCGATTGTCGTCATGATGCAGCGACAAGAGGCCAAGGTCAGCCAGGGTGCTGCCTGGATCTCTGACTTCCTGGCATCC
AACGGCGTCAGCATTGTTCCCAAGAGCATGCTGACGGCCGACGGCCTGATGCTGGCCCGGGAGAGCGACCCGGTCGCGCT
GGAGGCGGACAGCGAGGGCGCGGACGCCGAGAGGCAGGTCGAGGCCGAGACGGTCGAGACGGTTGAGACGGCCGAGACGG
CTGAGACAGCCGAAGCCGAGGGCGCAGCCAACCATGTGGGAAGAGGACGCCGGCAAGTGGGGGAGACTGGCGGCGACGTG
GAGGGAGGAAACGACCTCAGCGATGCAGATGCTGTGTTTGGTGACGACGAGGGGTCACCGAGCGCGATAGAGGACACCGA
CCAGGCCGATCCGGGGCCACACAAGGACAAGCAGCCGGCACAGAAGCAAGTACAGCCAAAGAAGAAACAGCCACAGAAAC
AGAGCAAAGCAGCACAACCGCCGTCACCACCACTACCAGCAGCAGCAGCAGCAGCAGCAAGTGGACAATAGAAGACGTCA
AGGAGAGGCAGTAATATGGCAGACATAGGAGGGCGCGAGGCTCTCGGACGCGGACTCGACTTGGCCCGTAGGGGATTTCA
CGGCCACTCGACCGGACCCAGGGACCAAGACGTGATTCTGTTTTGTTTGCCGGGAAATCCTGCTCTCTCGCTCCCCTCTC
GCTGCTCTTGCGCTTACTCTTGCTCTTGCTCTCTGGGTTGTCTACTTTGCCAAAGCCGCGTTTTGTCTGTACGCAACGTT
CGCGCTATCTCGGAGCCCTGGGCGTGTCTACAGTGTCTTACTCCCCCCTTTTCCCTGGGCAGCTGGGCCTCTCATCTCCT
GCTAGTGGTGTTGGGATGTGCATACTCTGCCCATGTGCAAATACAATCATCTGCCGGAGCCTCGTCTCTCGATTTATCCC
GTGATCGTTGGAACAGACGTAGCTGTCAGAATGGATCCCACAGCCGCGTTGTGGAGTGGCTTACGCCAGAGACCAGTCAT
TCCCCATGTCTCTTCCCCCACGAATTGACGGAAGCCGTCCTGCCCTCACCGACTTTTTCCGGCTTTCCCCAACGGCTGTG
CCTTGCCCCGTTTCTCAGGCGCAGGAGGGACCAAGTAATGTATCATTTCTGCCATCTGCAATGTCTATGTGGGCGCTGTC
TATCGGGTCATGGATGGCTATGGGGGTTCCAATGAGGGCAGCCGTACATCAGCTGCACGAGCTGAAGATGTCGGCAATGC
ATCTCGACACAAGCCATGGAATGACATGTGCTAGGATCGTTGTTGCTTGCGAGCTCTTGTGTCTTTTCTGGGTGCACGAT
TGGATTCCATTTGCAAAATCCAGATGCAGGACAGGTTGACGGTAGAGAGTGGCAGGCGTTGTGGATTGAGCCTTGACAAG
TACTTTGAGAACATGTGGGGCCAAAACAAGACAGCCTTTATAAGCTATGTTTTGAGAGCAATATTTCAGCGAAGTAGCTC
ACTGCAACTAATGGGCCTACCTTTCCATCTCTGCAACTCGAGAGTAGCAGAACCTTCGCTTTTTGCATTTCGACTGGCTG
GGATTCCTACCCCCTTTTTCTTCGTACCTCATACATTACGACTCTACCCGTTGCGAGAAGTCGCAGCCGTGGTTCGTCGC
CCATCGACCTCTACAGCCTTAAGGAGCCGTTTTGGTGCAATGGCAAGACAGCCTTCCTACGCCCGTTGCAGTCCCGTGTT
CGAGCCACGGCGCAGGTTGTTTTTTTCTGTCAGATGCGATGTATCTCCTGTATGCCCAAACCCGGCGAATGAGTCATTTG
GTACTTACGATCCTTCGAGGTTGGCCTCAGCCAAGTGGCAGGTTGGCCTCAGCAGAACTTACTGTGGGGCATTTCCGGGT
ATATTAAATCCGCTGTCCGCTGTCTGCTGGCAGCGAACAATCCTTCCTCTCCCAGTTGTCTGCATAGCAAGCCCGAAGAC
GCACCATGACGACTGATCAGCAGAACCCCAGGCAGAAGGCCTGGTATCTCCGGTCCAGCGTCCCGGTCTTCTTCCCAAGC
CATGCAGCCCTGCAGTTGCCCAGCAGCCAGTTCGAAGCCTTTCTGCAGACGGATCTGGCTAGCCGCACGGCCGAATTAGG
CAAAGGCCCGACCGTTGAGGCTGCTCCACAGTCGCTGATGGCGGACATCCGCGATGGACTCGATGCAGTCGTCCTCGATG
TCAACGACAATCCAAAACCAGCAACAGCAGAGCACCCGTTTGTGCAGGGCCTGCTGTCGGCGACCGAGCCGCAGGCGGTG
CCGGACCTGACGAACAAGATGCTGACAGACAACGGCGACGTGGCATTCCGGTCGACGGAGAACGCGCTCGTGGATCTCTT
CTCTGAGCTGCAGGAGGCGGTGTCGGGGCCACGGCTGGTCGACCTGCTGGACGCGGCGTGGGCCCAAGACAGCCTGGCGA
CGCTCAAGATGATCTTCAACGCGCGGTCGATCCACCTGGGCAAGAGCTCGCGCACGACGTTCTACCGCAGTGCCGGCTGG
CTGGCACAAAAGCATCCGCTGACGCTGGTGTCGAATCTGCGGTGGCTGAGCCGGCCGGTGATCGAGAAGAAGGTGGAGAA
GAAAGAGGCGGTTGTGGTTGAGTCACGTGACGTGGACGAGAGCGACCCTCTGCCTATTGATGTGCGCAACGGTGTGGCCC
ACGGATACTGGAAGGACCTGCTGAACCTGCTGGCGCTGGCGGCCAAAGGCAAGCTAGGACCTCTGGCGTCGCCGCACGAG
ATGCTGAACGTGGACGAGCGCACAAACAAGCGGGTGCGTATGGTGAACCAGGCGACGGCCAAGGCGAAGCGGCACGTGAC
GCGGACGAAACGACACGAGCGGGCAGTCGGGCTGTTCGAGACGGACTCGACGTACCGGGCGCTACACCTGAGTGTAGCGC
GGCTATTTACGGAGCAACTGAAGAGCGACCTGGCGGCGCTGCAGGGTGACAGCAAGGCGGCCCAGCAACAGATCTCGCTC
TGTGCCAAGTGGGTGCCAAGTGGGCGCCGTCGACCGACCGGTTCCACGACCGACACACGTTTGTGGTGTCATCGATCGCG
GAGCTGCTGTACCCGGCGTCTGCCTTTGGCGTGGCATCGTCGGACCGCGCGCTGTACCTGCGCCACGCGCGCGAGGCCTA
CCGCAAGGACGTGTCGGCGCTGCGGGCACACCTGGACGTGGTGGAGCGACACCTTTCGGCCGGGACGATGGGCGCGATCA
CGTACAGCCGCATTCCGTCGCTGGCGATGAAGGCGTACGCGGGCGTGTTCGCAGCCAAGGACGAGGCGCGGTTCGACGCG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62